Sybr green pcr mix

Gene expression was determined by SYBR Green qPCR, using SYBR Green PCR mix (Roche) and 2 µl cDNA as a template. RNA not subjected to reverse transcriptase was used as a negative control for PCR amplification. Gene-specific primers used are listed in Supplementary Table 2. Q-PCR was performed on a LightCycler LC480 instrument (Roche) (see AR Amplification). Crossing-point (Cp) values were determined using the LightCycler 480 SW 1.5 software (Roche). HPRT expression was used for normalization. Relative gene expression levels were calculated according to the model described by Pfaffl (18 (link)).

To estimate the concentration of E. coenophiala in samples, quantitative PCR (qPCR) was performed on the TefA (translation elongation factor 1- $\alpha$ ) gene using primers specific to Epichloë (forward primer 5′-CAATGCAGCGAGTGAACATC-3′ and reverse primer 5′-CACGTACTGACTGAAGCGTAGC-3′) on a Roche LightCycler 480 (Roche Diagnostics, Rotkreuz, Switzerland). Each reaction contained 6 $\mathsf{\mu }$ L DNA ( $0.5$   $\mathrm{n}$ $\mathrm{g}$ / $\mathsf{\mu }$ L), $7.5$   $\mathsf{\mu }$ L SYBR Green PCR mix (Roche Diagnostics, Rotkreuz, Switzerland), and  $0.75$   $\mathsf{\mu }$ L of each primer (at 10 $\mathsf{\mu }$ $\mathrm{mol}$ concentration) and each sample had three technical replicates. Each qPCR plate also included a negative control (water). The PCR program was: 95 ${}^{\circ }\mathrm{C}$ for 5 $\min$ ; 45 cycles of 95 ${}^{\circ }\mathrm{C}$ for 10 $\mathrm{s}$ , 64 ${}^{\circ }\mathrm{C}$ for 15 $\mathrm{s}$ , and  72 ${}^{\circ }\mathrm{C}$ for 15 $\mathrm{s}$ ; followed by 95 ${}^{\circ }\mathrm{C}$ for 5 $\mathrm{s}$ , 65 ${}^{\circ }\mathrm{C}$ for 1 $\min$ , continuous acquisition at 97 ${}^{\circ }\mathrm{C}$ , and  40 ${}^{\circ }\mathrm{C}$ for 30 $\mathrm{s}$ to obtain the melt curve. For further details about the qPCR protocol, see Ryan et al. [35 (link)].

Total RNA was extracted from normal (n = 12) and psoriatic (n = 14) keratinocytes. Vim, FN, PAI-1, E-cad, N-cad, β-catenin, K10, K14, K16, Snail, Slug and β-actin mRNA were analysed by quantitative real-time PCR (qRT-PCR). The primers used for PCR were designed by Beacon Designer v. 8.0 (Premier Software) and are listed in the electronic supplementary material, table S2. A total of 2 µg RNA was reversed into cDNA by using Superscript II Reverse Transcriptase (Invitrogen). Gene expression was determined using SYBR green PCR mix (Roche) and 10 ng of template. Real-time PCR was performed on an ABI StepOne Plus instrument, using the following amplification conditions: 10 s at 95°C, followed by 40 cycles of 10 s at 95°C and 1 min at 60°C. CT values were analysed using qBase Plus 2 software (Biogazelle, Zwijnaarde, Belgium).

Total RNA was isolated with TriZol reagent according to the manufacturer’s instructions (Life Technologies). Reverse transcription was performed from 1 μg of total RNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics, Basel, Switzerland) and random hexamer primers. PCR amplification was performed on the LightCycler 480 system with SYBRGreen PCR mix (Roche Diagnostic) and the following primers: HGS forward 5’- CTCCTGTTGGAGACAGATTGGG -3’ and HGS reverse 5’- GTGTGGGTTCTTGTCGTTGAC -3’, 18S forward 5’-GTAACCCGTTGAACCCCATT-3’ and 18S reverse 5’-CCATCCAATCGGTAGTAGCG-3’, CTNNB1 forward 5’- GCTTTCAGTTGAGCTGACCA-3’ and CTNNB1 reverse 5’-GCTTTCAGTTGAGCTGACCA-3’ or Axin2 forward 5’- TGTCTTAAAGGTCTTGAGGGTTGAC-3’ and Axin 2 reverse 5’- CAACAGATCATCCCATCCAACA-3’.

Real-time quantitative RT-PCR (q-PCR) was used to detect the expression levels of Notch ligands Dll1, Dll4, Jagged1 and Jagged2 in the peripheral blood. Total RNA was extracted using TRIzol (Invitrogen) and the single-stranded cDNA was synthesized using M-MLV reverse transcriptase (Invitrogen). Real-time qPCR was performed with the SYBR Green PCR Mix on a LightCycler System (Roche). The primers sequences used were hJAG1 sense-5’-AATGGTTATCGCTGTATCTG-3’ and antisense-5’-TCACTGGCACGGTTGTAG-3’, hJAG2 sense-5’-AGTTCCAGTGCGATGCCTACA-3’ and antisense-5’-GCTACAGCGATACCCGTTGAT-3’, hDLL1 sense-5’-GGGTCATCCTTGTCCTCAT-3’ and antisense-5’-CTTGGTGTCACGCTTGCT-3’, hDLL4 sense-5’-ACAGCCTATCTGTCTTTCGG-3’ and antisense-5’-GGCAGTGGTAGCCATCCT-3’ and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), sense-5’-AAGCTCACTGGCATGGCCTT-3’ and antisense-5’-CTCTCTTCCTCTTGTGCTCTT G-3’. The transcript abundance was calculated using the ΔΔCt method, and the mRNA expression level of each Notch ligand was the ratio of normalized mean of GAPDH.

PCR primers for evaluating ChIP or sequential ChIP assays were designed to amplify 150–200 base pair fragments from the promoter regions as follows: PROX1 (forward: 5’-GACCCCCAGATTCCCAGGTCCTTCT-3’; reverse: 5’-AAGCCAGATTTCTATATTTTTTCTG-3’), PML (forward: 5’-TTTCGGACAGCTCAAGGGAC-3’; reverse: 5’-TTAGTTTCGATTCTCGGTTT-3’), TGFBR2 (forward: 5’-AGCTGTTGGCGAGGAGTTTC-3’; reverse: 5’-AGGAGTCCGGCTCCTGTCCC-3’), and TGFB3 (5’-GGGAGTCAGAGCCCAGCAAA; reverse: 5’-TGGCAACCCTGAGGACGAAG-3’). PROX1 coding sequence region primer (forward: 5’-GAGCCCTGATCAGAGAGCAGGAAA; reverse: 5’-GACTTTGACCACAGTGTCCACAAC). Real-time PCR was carried out using SYBR Green PCR mix (Roche) in Roche LightCycler 480II Instrument.
RNA was isolated using an Ultrapure RNA Kit (CWBIO CW0581), reverse transcribed (Takara), and quantified using SYBR green PCR master mix on a Roche LightCycler 480II. The following primers (5’-3’) were used: VEGF-A (forward: AGGGCAGAATCATCACGAAGT; reverse: AGGGTCTCGATTGGATGGCA), VEGF-B (forward: GAGATGTCCCTGGAAGAACACA; reverse: GAGTGGGATGGGTGATGTCAG), VEGF-C (forward: GAGGAGCAGTTACGGTCTGTG; reverse: TCCTTTCCTTAGCTGACACTTGT), VEGF-D (forward: ATGGACCAGTGAAGCGATCAT; reverse: GTTCCTCCAAACTAGAAGCAGC), vIL-6 (forward: TCGTTGATGGCTGGTAG; reverse: CACTGCTGGTATCTGGAA), and vGPCR (forward: AACCATCTTCTTAGATGATGAT; reverse: AATCCATTTCCAAGAACATTTA).