Total RNA was extracted with TRIzol Reagent (Invitrogen) and reverse-transcribed into cDNA with ABScript III Reverse Transcriptase (Abclonal, Wuhan, China). Then, the amplification was performed in triplicate using Universal SYBR green Fast qPCR Mix (Abclonal, Wuhan, China). The melting curves were checked and the relative gene expression was analyzed using the 2−ΔΔCt method with normalization to GAPDH and ACTB. The primer (Sangon Biotech, Shanghai, China) sequences are listed in Table S3 .
Abscript 3 reverse transcriptase
Manufactured by ABclonal
Sourced in China
ABScript III Reverse Transcriptase is an enzyme used for the conversion of single-stranded RNA into complementary DNA (cDNA). It catalyzes the synthesis of a DNA strand from an RNA template.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Universal sybr green fast qpcr mix, by ABclonal (1 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Chamq sybr qpcr master mix, by Vazyme (1 mentions)
Fastpure cell tissue total rna isolation kit, by Vazyme (1 mentions)
Genious 2x sybr green fast qpcr mix, by ABclonal (1 mentions)
Qubit rna hs assay kit, by Thermo Fisher Scientific (1 mentions)
Mirna 1st strand cdna synthesis kit, by Vazyme (1 mentions)
Sybr green supermix, by Bio-Rad (1 mentions)
Cfx96 real time pcr system, by Bio-Rad (1 mentions)
Rnaprep fastpure tissue cell kit, by Tsingke (1 mentions)
Abscript 2 one step sybr green rt qpcr kit, by ABclonal (1 mentions)
6 protocols using abscript 3 reverse transcriptase
1
RNA Extraction and qPCR Analysis
2
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cell and tissue total RNA was extracted using FastPure Cell/Tissue Total RNA Isolation Kit (Vazyme, Nanjing, China). NanoDrop 2000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) was used for RNA concentration detection. 1000 ng of the RNA was reverse transcribed into cDNA using ABScript III Reverse Transcriptase (ABclonal, Wuhan, China) according to the manufacturer’s instruction. Then RT-qPCR experiment was performed using ChamQ SYBR qPCR Master Mix (Vazyme, Nanjing, China). The primers for qPCR were obtained from TSINGKE (Guangzhou, China), and the primer sequences were as follows (from 5’ to 3’): METTL3: TTGTCTCCAACCTTCCGTAGT (forward) and CCAGATCAGAGAGGTGGTGTAG (reverse); CYP19A1: TGGAAATGCTGAACCCGATAC (forward) and AATTCCCATGCAGTAGCCAGG (reverse); ESR2: AGCACGGCTCCATATACATACC (forward) and TGGACCACTAAAGGAGAAAGGT (reverse); GAPDH: GGAGCGAGATCCCTCCAAAAT (forward) and GGCTGTTGTCATACTTCTCATGG (reverse).
3
Total RNA Extraction and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using a total RNA extraction reagent (ABclonal). RNA was reverse-transcribed to complementary DNA (cDNA) with ABScript III Reverse Transcriptase (ABclonal). Quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) was performed using Genious 2X SYBR Green Fast qPCR Mix (ABclonal). The 20 μL reaction mixture contained 400 nM primers, 10 μL of SYBR Green Fast qPCR Mix, 2 μL of template cDNA, and nuclease-free water. cDNA amplification was conducted via Archimed X6 quantitative real-time PCR (RocGene) following the manufacturer’s instructions. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control.
4
Comprehensive RNA Extraction and Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated employing an RNA quick purification kit (Yishan, Shanghai, China), and the RNA integrity was assessed using the Qubit™ RNA HS Assay Kit (Invitrogen, Carlsbad, CA). Complementary DNA (cDNA) was synthesized using the ABScript III Reverse Transcriptase(Abclonal, Suzhou, China). Regarding miRNA, complementary DNA (cDNA) was synthesized in a reverse transcription reaction using stem-loop primers and the miRNA 1st Strand cDNA Synthesis Kit (Vazyme, Nanjing, China). Quantitative real-time polymerase chain reaction (qRT-PCR) was conducted utilizing the SYBR method. The 2−ΔΔCt method was employed to determine relative expression levels, with GAPDH or U6 serving as internal controls. Reference for primers can be found in supplementary table 3 .
5
Quantitative Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from fat body tissue using TRIzol reagent (cat #15596026; Thermo Fisher Scientific) and used as a template for cDNA synthesis using ABScript III Reverse Transcriptase (cat #RK20408; Abclonal). RT-PCR reactions were performed using SYBR Green Supermix (cat #1725120; Bio-Rad) in a CFX96 Real-Time PCR system (Bio-Rad). Expression values were normalized to Rp49 transcript levels. The relative expression level with respect to the wild-type control was calculated by the Delta–Delta Ct method. Three separate biological replicates were performed for each experiment, each with three technical replicates. Primers used were as follows: eclair-rt-F, eclair-rt-R; p24-2-rt-F, p24-2-rt-R; CHOp24-rt-F, CHOp24-rt-R; CG9308-rt-F, CG9308-rt-R; logjam-rt-F, logjam-rt-R; opossum-rt-F, opossum-rt-R; CG31787-rt-F, CG31787-rt-R; p24-1-rt-F, p24-1-rt-R; baiser-rt-F, baiser-rt-R; and Rp49-rt-F, Rp49-rt-R. Primer sequences are listed in Table S2 .
6
Quantification of CENP Genes in LUAD
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used the RNAprep FastPure Tissue & Cell Kit (Tsingke Biotechnology, Beijing, China) and ABScript III Reverse Transcriptase (ABclonal, Wuhan, China) to extract messenger RNA (mRNA) from LUAD and normal tissue and performed reverse transcription according to the manufacturer’s protocol. Finally, qRT-PCR experiments were carried out using ABScript II One-Step SYBR Green RT-qPCR Kit (ABclonal). The primer sequences were as follows: CENPW: 5'-GAT GGA ACT GGC TGA GAC ACT AAC C-3' (forward) and 5'-AAG ACT CTT GCT TGA TGC TGA GGT G-3' (reverse); CENPM: 5'-ACA GCA AAT ACA GTC TCC AGA A-3' (forward) and 5'-GAA ACA CAC CTT CCC CAA GAA-3' (reverse); CENPU: 5'-GAA AAG AAA AGG CAG CGT ATG A-3' (forward) and 5'-AAT ATG CTG CAT TCC TAA GGG A-3' (reverse); CENPF: 5'-TAC AAC GAG AGA GTA AGA ACG C-3' (forward) and 5'-CTA CCT CCA CTG ACT TAC TGT C-3' (reverse); CENPH: 5'-TTC CAG AAC CTT ATT TTG GGG A-3' (forward) and 5'-CTT CTC AAG CTG CAG AAC AAT T-3' (reverse).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!