Sensifast probe lo rox mix

Total RNA was isolated from the excised tissues using RecoverALL Total Nucleic Acid Isolation Kit (Ambion™, Life Technologies, USA). Reverse transcription was performed with TaqMan miRNA primers and TaqMan microRNA Reverse Transcription Kit (Applied Biosystems, Life Technologies Corporation, USA). Expression of miR-410 was determined by real-time PCR using Taqman MicroRNA Assay (Assay ID 001274; miRBase Accession Number MI0002465; Stem-loop Sequence GGUACCUGAGAAGAGGUU-GUCUGUGAUGAGUUCGCUUUUAUUAAUGACGAAUAUAACACAGAUGGCCUGUUUUCAGUACC; Applied Biosystems, Life Technologies Corporation, USA), sensiFAST Probe Lo-ROX Mix (Bioline, USA) with the Applied Biosystems 7500 Fast Real-Time PCR System, and 7500 Software V2.0.6 (Life Technologies Corporation 2011). U6 snRNA was used as an endogenous control (Assay ID 001973; NCBI Accession # NR_004394; Control Sequence: GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATA-CAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTT). PCR conditions were in accordance with the manufacturer’s protocol. The relative expression of miR-410 was calculated automatically by the comparative Ct method.

The quantification of chromosomal DNA at each time point was accurately determined by performing 5′-exonuclease (TaqMan) assays with unlabelled primers and carboxyfluorescein/carboxytetramethylrhodamine (FAM/TAMRA) dual-labelled probes. A pan chlamydial PCR assay was developed, primers and probe sequences were as follows,:
CM_omcB_F (5’-GGAGATCCTATGAACAAACTCATC-3’),
CM_omcB_R (5’-TTTCGCTTTGGTGTCAGCTA-3’),
CM_omcB_Probe (5’-FAM-CGCCACACTAGTCACCGCGAA-TAMRA-3’).Five microliters of each sample was added to 20µl reaction mixture containing forward primer (400nM), reverse primer (400nM), probe (200nM) and SensiFAST Probe Lo-ROX mix (Bioline). Real-time PCR cycles (95°C for 5 minutes, followed by 40 cycles of 95°C for 10 seconds and 60°C for 50 seconds) were performed in a 7500 Fast Real-Time PCR System (Applied Biosystems).
A standard curve was prepared using plasmid DNA prepared in
E.coli (pSRP1A) containing the
omcB gene from
C. trachomatis L1, which has identical priming sites in the
C. muridarum chromosome
^{23 (link)}.

The qPCR reactions were performed in a total volume of 30 μl containing 2.3 μl of 20 mg/ml bovine serum albumin (BSA; Sigma A2153), 15.05 μl of SensiFAST Probe Lo-ROX Mix (Bioline BIO84005), 3.05 μl of forward primer (5 pmol/μl), 3.05 μl of reverse primer (5 pmol/μl), 1.55 μl of TaqMan probe (5 pmol/μl), and 5 μl of DNA extract. The primers and probes used were as follows:
For B. anthracis, the chromosomal marker targeting prophage lambdaBa03 (PL3; Weigel et al., 2010 (link)), PL3_F: AA AGCTACAAACTCTGAAATTTGTAAATTG, PL3_R: CAACG ATGATTGGAGATAGAGTATTCTTT, and Tqpro_PL3: FAM- AACAGTACGTTTCACTGGAGCAAAATCAA-BHQ-1. For Y. pestis, the gene capR encoding the Lon ATP-dependent serine protease (Steinberger-Levy et al., 2016 (link)), capF: GGATT ACGATCTCTCGGATGTGA, capR: AGCCGGACAGACGAAT AACTTC, and Taq-CapR: FAM-TTGTGGCGACCTCTAAC TCCATGAATATTCC-BHQ-1. For F. tularensis, the gene fopA encoding an outer membrane protein (Versage et al., 2003 (link)), fopAF: ATCTAGCAGGTCAAGCAACAGGT, fopAR: GTCAACACTTGCTTGAACATTTCTAGATA, and fopAP: FA M-CAAACTTAAGACCACCACCCACATCCCAA-BHQ-1. The PCR thermal conditions were as follows: 3 min at 60°C followed by 40 cycles of 15 s at 95°C and 35 s at 60°C.