H2bub1

ChIP was performed as previously described [13 (link),15 (link)]. H3K27ac (C15410196, Diagenode) and H2Bub1 (5546, Cell Signaling) occupancy was determined in HCT116 cells with a siRNA-mediated USP22 depletion as well as control cells (NT5). IgG (C15410206, Diagenode) was used as a negative control and samples were compared to inputs. Primer sequences for subsequent qPCR were as follows: H3K27ac SPARC pos. F 5′-ATGTCGATGTGGCAGCTGAT-3′, H3K27ac SPARC pos. R 5′-ATTAGAGGGCATGACGTGGG-3′; H3K27ac/H2Bub1 SPARC neg. F 5′-GAGAGACCACTTACCCGCAG-3′, H3K27ac/H2Bub1 SPARC neg. R 5′-TACAGGGTGACCAGGACGTT-3′; H2Bub1 SPARC pos. F 5′-GGCCCAAGGACACTCACATT-3′, H2Bub1 SPARC pos. R 5′-CCTTCGACTCTTCCTGCCAC-3′.

SEM cells were treated with 50 nM bortezomib or media for 0, 2, 4, and 6 h at 37 °C. CUTANA^TM CUT&RUN kit (EpiCypher 14-1048) was used, according to manufacturer’s instructions, to immunoprecipitate chromatin bound by MLL (Bethyl A300-086A), H2Bub1 (Cell Signaling 5546T), and normal rabbit IgG (CUTANA^TM CUT&RUN kit negative control). qPCR for MEIS1 exon 1 and CDK6 exon 1 was performed using PowerUP^TM SYBR^TM Green Master Mix (ThermoFisher A25742). Fold enrichment was calculated relative to the normal rabbit IgG control and then normalized to 0 h. MEIS1 exon1 primers: Forward GGAGCGCTTTTATGCTCAGT Reverse ATCCCTTAACGTCTCCAGCA. CDK6 exon1 primers: TTATCCTCCTCCCGTCTCCTCCT Reverse CTCGAAGCGAAGTCCTCAAC.