The entire hypothalamus of late pregnant NestinΔGHR (n = 8) and control (n = 7) mice was collected and RNA was extracted with TRIzol (Invitrogen, Carlsbad, CA), followed by incubation in DNase I RNase-free (Roche Applied Science) and then reverse transcription using 2 μg of total RNA, SuperScript II Reverse Transcriptase (Invitrogen) and random primers p(dN)6 (Roche Applied Science). Real-time PCR was performed using the 7500TM Real-Time PCR System (Applied Biosystems, Warrington, UK), Power SYBR Green Gene Expression PCR Master Mix (Applied Biosystems) and specific primers for target genes: Actb (forward: gctccggcatgtgcaaag; reverse: catcacaccctggtgccta), Gapdh (forward: gggtcccagcttaggttcat; reverse: tacggccaaatccgttcaca), Ghr (forward: atcaatccaagcctggggac; reverse: acagctgaatagatcctgggg), Stat5a (forward: cgctggactccatgcttctc; reverse: gacgtgggctcctcacactga) and Stat5b (forward: ggactccgtccttgataccg; reverse: tccatcgtgtcttccagatcg). Data were normalized to the geometric average of Actb and Gapdh. Relative quantification of mRNA was calculated by 2−ΔΔCt.
Power sybr green gene expression pcr master mix
Manufactured by Thermo Fisher Scientific
Sourced in United Kingdom
Power SYBR Green Gene Expression PCR Master Mix is a ready-to-use solution for quantitative real-time PCR analysis of gene expression. It contains SYBR Green I dye, DNA polymerase, dNTPs, and optimized buffer components.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using power sybr green gene expression pcr master mix
1
Quantifying Hypothalamic Gene Expression in Pregnant Mice
2
Hypothalamic Gene Expression in Leptin-Deficient Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In this study, 7-or 12-day-old male and female Lep ob/ob mice and lean littermates fed ad libitum were decapitated, and the entire hypothalamus was collected. To evaluate the effects of fasting and leptin replacement, 10-day-old C57BL/6 mice were subjected to an overnight fast (16 h). At the moment of separation from the dams, the pups received a s.c. injection of either PBS or leptin (10 µg/g of body weight). The following morning, the pups received a second injection of PBS or leptin and were sacrificed 3 h later. A group of 10-day-old C57BL/6 mice fed ad libitum also received PBS injections at the same time and were used as controls. The hypothalamus was collected to determine the gene expression. Total RNA was extracted with TRIzol (Invitrogen). Real-time PCR was performed using the 7500TM Real-Time PCR System (Applied Biosystems), Power SYBR Green Gene Expression PCR Master Mix (Applied Biosystems) and specific primers for target genes (Table 1). Data were normalized to the geometric average of Actb, Gapdh and Ppia.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!