Genomic DNA was extracted from 2 ml of whole blood in ethylenediaminetetraacetic acid (EDTA) tubes using the QIAamp DNA Blood Midi Kit (Qiagen, Hilden, Germany). DNA concentration was measured using the Qubit Flourometer (Invitrogen, Carlsbad, USA) with the Quanti-iT dsDNA Broad Range assay kit (ThermoFisher, Massachusetts, USA), according to the manufacturer’s instructions. DNA methylation analysis was performed using pyrosequencing. Briefly, 500 ng of DNA was bisulfite converted using the EpiTech Fast DNA Bisulfite Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. PCR was performed on 20 ng of bisulfite converted DNA using the Pyromark PCR kit and pyrosequencing was conducted using the PyroMark Gold Q96 reagent kit and the PyroMark Q96 pyrosequencer (Qiagen). Bisulfite treatment and pyrosequencing assays were tested using bisulfite conversion controls and methylated standards (0% to 100%) (S1 Fig ) (Qiagen), according to manufacturer’s instructions. Samples were randomly selected and tested in duplicate to confirm reproducibility of methylation data.
Pyromark q96 pyrosequencer
Manufactured by Qiagen
Sourced in Canada, Germany
The PyroMark Q96 pyrosequencer is a DNA sequencing instrument designed for analyzing short DNA sequences. It utilizes the pyrosequencing technology to generate accurate and reproducible sequencing data. The core function of the PyroMark Q96 is to perform pyrosequencing analysis on DNA samples, providing researchers with detailed sequence information.
Automatically generated - may contain errors
Lab products found in correlation
Pyromark gold q96 reagent kit, by Qiagen (1 mentions)
Pyromark pcr kit, by Qiagen (1 mentions)
Qubit flourometer, by Thermo Fisher Scientific (1 mentions)
Qiaamp dna blood midi kit, by Qiagen (1 mentions)
Epitech fast dna bisulfite kit, by Qiagen (1 mentions)
Quanti it dsdna broad range assay kit, by Thermo Fisher Scientific (1 mentions)
Qiasymphony dna mini kit, by Qiagen (1 mentions)
Pyro q cpg software, by Qiagen (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Takara epitaq hs, by Takara Bio (1 mentions)
Pyromark assay design software, by Qiagen (1 mentions)
Epitect bisulfite kit, by Qiagen (1 mentions)
Pyromark cpg software, by Qiagen (1 mentions)
10 protocols using pyromark q96 pyrosequencer
1
Quantification of DNA Methylation by Pyrosequencing
2
APOE Genotyping for Alzheimer's Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In PREVENT-AD, APOE genotype was determined using the PyroMark Q96 pyrosequencer (Qiagen, Toronto, ON, Canada). DNA was amplified using RT-PCR with primers rs429358 amplification forward 5’-ACGGCTGTCCAAGGAGCT G-3’, rs429358 amplification reverse biotinylated 5′-CACCTCGCCGCGGTACTG-3′, rs429358 sequencing 5′-CGGACATGGAGGACG-3′, rs7412 amplification forward 5′-CTCCGCGATGCCGATGAC-3′, rs7412 amplification reverse biotinylated 5′-CCCCGGCCTGGTACACTG-3′ and rs7412 sequencing 5′-CGATGACCTGCAGAAG-3′. In ADNI, APOE genotypes had been determined using DNA extracted by Cogenics (Beckman-Coulter, Pasadena, CA) [27 (link)].
3
Quantitative DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative pyrosequencing was performed to assess DNA methylation levels of SOD3 in n = 603 samples. EPAS1 methylation was available from Childebayeva et al. (2019) (link). The following primer sequences were used to amplify the region of interest: SOD3 forward primer sequence: 5′-[biotin]-TTGTGTGTTGAAGGTTATTGGTTATAAG-3′ ; SOD3 reverse primer sequence: 5′ -CCTCCTCTACCCCTCCCATTTTT-3′ ; SOD3 sequencing primer: 5′ -ACCCCTCCCATTTTTA-3′ . We assessed the DNA methylation levels at four CpG sites in SOD3 using the Pyromark Q96 pyrosequencer (Qiagen, Valencia, CA), for more details, see Virani et al. (2012) . Of the 603 samples analyzed using pyrosequencing, 104 either failed pyrosequencing or had high coefficient of variance (CV > 10) between duplicates and were excluded from the statistical analyses for SOD3.
4
APOE Genotyping from Blood Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA extraction, PCR amplification and genotyping of APOE from blood samples was obtained as previously described [49 (link)]. DNA extraction from buffy coat samples was performed using the QiaSymphony DNA mini kit (Qiagen, Toronto, ON, Canada). APOE genotyping was determined via PyroMark Q96 pyrosequencer (Qiagen, Toronto, ON, Canada). RT-PCR with the following primers was used for DNA amplification: forward primers 5’- ACGGCTGTCCAAGGAGCTG-3’ (rs429358) and 5’-CTCCGCGATGCCGATGAC-3’ (rs7412), and reverse biotinylated primers 5’-CACCTCGCCGCGGTACTG-3’ (rs429358) and 5’-CCCCGGCCTGGTACACTG-3’ (rs7412). The following primers were used for DNA sequencing: 5’-CGGACATGGAGGACG-3’ (rs429358) and 5’-CGATGACCTGCAGAAG-3’ (rs7412).
5
Determining APOE Genotype from Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from whole blood, and apolipoprotein E (APOE) genotype was determined using the PyroMark Q96 pyrosequencer (Qiagen), as described previously. 27 (link) Participants were classified as APOE ε4 carriers (ie, those who had 1-2 ε4 alleles) or noncarriers.
6
Cord Blood Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For methylation analysis of cord blood, NEST participants were selected based on the availability of recent follow-up data at the time of sample analysis, consent to epigenetic analyses at enrollment, and additional consent to follow-up epigenetic analysis for offspring from ages 3–5 years during follow-up visits. Methylation was assessed in at least one ICR for 1296 participants. Procedures for specimen collection, handling, and methylation are described elsewhere [27 (link),40 (link),71 (link)]. Briefly, DNA for pyrosequencing was extracted from offspring cord-blood buffy coat using Puregene (Qiagen, Germantown, MD) reagents. Pyrosequencing was performed on a Pyromark Q96 Pyrosequencer (Qiagen, Germantown, MD). Primers and PCR conditions are described in detail elsewhere [11 (link),72 (link)]. The methylation fraction for each CpG dinucleotide was calculated using PyroQ CpG Software (Qiagen, Germantown, MD). The methylation fraction was analyzed at multiple CpGs of DMRs (n) in the ICRs of H19 (4), IGF2 (3), MEG3-IG (4), MEG3 (8), MEST (4), PEG3 (10), PLAGL1 (6), NNAT (3), and SGCE/PEG10 (6). Due to quality control methods, minor differences in sample sizes exist depending on the CpG. Note that these regions are considered established ICRs and are referred to as such in the text.
7
Quantifying DNA Methylation by Bisulfite Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bisulfite-specific primers were designed using MethPrimer (45 (link)). PCRs (2.5 µl bsDNA) were performed using TaKaRa EpiTaq™ HS (Takara Bio Inc., Japan) and amplicons purified with the QIAquick PCR Purification Kit (QIAGEN, Germany). Sanger sequencing of the samples was carried out by GATC Biotech (Germany). Quantification of dBSP was done as described previously (46 (link)). In order to avoid over-representation of cytosine peaks after normalization, the raw sequencing data were used for quantification (CodonCode Aligner Software, version 5.1.5, CodonCode Corporation, USA). Primers for pyrosequencing were designed using the PyroMark Assay Design software (QIAGEN, Germany). Pyrosequencing was performed on a PyroMark Q96 Pyrosequencer according to the manufacturer’s instructions and quantified using PyroMark Q96 software 2.5.7 (QIAGEN, Germany).
8
Genotyping of ADAD and APOE Variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DIAN genotyping was performed by the DIAN Genetics Core at Washington University22 (link). The presence or absence of ADAD mutation was determined using PCR-based amplification of the appropriate exon followed by Sanger sequencing. APOE genotype was determined using an ABI predesigned real-time Taqman assay (C___3084793_20 and C____904973_10 for rs429358 and rs7412 variants, respectively).
APOE genotype in PREVENT-AD was determined using the PyroMark Q96 pyrosequencer (Qiagen, Toronto, Canada) and the following primers: rs429358_amplification_forward 5′-ACGGCTGTCCAAGGAGCTG-3′, rs429358_amplification_reverse_biotinylated 5′-CACCTCGCCGCGGTACTG-3′, rs429358_sequencing 5′-CGGACATGGAGGACG-3′, rs7412_amplification_forward 5′-CTCCGCGATGCCGATGAC-3′, rs7412_amplification_reverse_biotinylated 5′-CCCCGGCCTGGTACACTG-3′ and rs7412_sequencing 5′-CGATGACCTGCAGAAG-3′.
The full list of primers is provided in Supplementary Tables3 and 4 .
APOE genotype in PREVENT-AD was determined using the PyroMark Q96 pyrosequencer (Qiagen, Toronto, Canada) and the following primers: rs429358_amplification_forward 5′-ACGGCTGTCCAAGGAGCTG-3′, rs429358_amplification_reverse_biotinylated 5′-CACCTCGCCGCGGTACTG-3′, rs429358_sequencing 5′-CGGACATGGAGGACG-3′, rs7412_amplification_forward 5′-CTCCGCGATGCCGATGAC-3′, rs7412_amplification_reverse_biotinylated 5′-CCCCGGCCTGGTACACTG-3′ and rs7412_sequencing 5′-CGATGACCTGCAGAAG-3′.
The full list of primers is provided in Supplementary Tables
9
MLH1 Promoter Methylation Analysis for Lynch Syndrome
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After sodium bisulfite conversion using the EpiTect Bisulfite Kit (Qiagen, Hilden, Germany) according to the manufacturer's guidelines, the MLH1 promoter area was amplified via polymerase chain reaction (PCR; forward primer, GTATTTTTGTTTTTATTGGTTGGATAT and reverse primer, AATACCAATCAAATTTCTCAACTCTA) and then sequenced using a PyroMark Q96 Pyrosequencer (sequencing primer: TTAAAAATGAATTAATAGGA) with the PyroMarkCpG software (Qiagen, Hilden, Germany) for methylation assay according to the manufacturer's protocol and prior report [18] 18. Newton, K. • Jorgensen, N.M. • Wallace, A.J. ... Tumour MLH1 promoter region methylation testing is an effective prescreen for Lynch Syndrome (HNPCC) J Med Genet. Dec 2014; 51:789-796 Crossref Scopus (62) PubMed Google Scholar . Cases with hypermethylated MLH1 were considered if the mean DNA copy number was higher than 8%.
10
APOE Genotyping using Pyrosequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
APOE genotype was determined using the PyroMark Q96 pyrosequencer (Qiagen, Hilden, Germany). DNA was amplified using polymerase chain reaction (PCR) with the following primers: rs429358 forward 5'-ACGGCTGTCCAAGGAGCTG-3', rs429358 reverse biotinylated 5'-CACCTCGCCGCGGTACTG-3', rs429358 sequencing 5'-CGGACATGGAGGACG-3', rs7412 forward 5'-CTCCGCGATGCCGATGAC-3', rs7412 reverse biotinylated 5'-CCCCGGCCTGGTACACTG-3', and rs7412 sequencing 5'-CGATGACCTGCAGAAG-3'.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!