Total RNA was isolated using TRIZOL reagent (Invitrogen) in accordance with the manufacturer’s instructions, and the first-strand cDNA was synthesised with the RT-PCR kit (TAKARA) in accordance with the manufacturer’s instructions. Applied Biosystems 7500 Real-Time PCR System software was used for real-time PCR analysis. The analysis was performed with SYBR green I fluorescence (Applied Biosystems). Quantification of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA (as an internal control for gene expression in the cells) was performed with TaqMan Human GAPDH Control Reagents. SYBR Green qPCR SuperMix (Roche) was used in an ABI 7500HT Real-Time PCR System (Applied Biosystems, Foster City, CA). PCR products were separated on a 1.0% agarose gel. The primers used in this study were as follows: GAPDH-forward-primer: 5′-GGAGCGAGATCCCTCCAAAAT-3′; GAPDH-reverse-primer: 5′-GGCTGTTGTCATACTTCTCATGG-3′; p53-forward -primer: 5′-CAGCACATGACGGAGGTTGT-3′; p53-reverse-primer: 5′-TCATCCAAATACTCCACACGC-3′; p21-forward-primer: 5′-TGTCCGTCAGAACCCATGC-3′; p21-reverse-primer: 5′-AAAGTCGAAGTTCCATCGCTC-3′; Mdm2-forward-primer: 5′-GAATCATCGGACTCAGGTACATC-3′; Mdm2-reverse-primer: 5′-TCTGTCTCACTAATTGCTCTCCT-3′. Other primer sequences are provided in the supporting information.
7500 real time pcr system software
Manufactured by Thermo Fisher Scientific
Sourced in United States
The 7500 Real-Time PCR System software is a tool designed for the analysis and interpretation of data generated by the 7500 Real-Time PCR System. It provides the necessary functionality to set up experiments, monitor reactions, and analyze the resulting data.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Sybr green 1 fluorescence, by Thermo Fisher Scientific (2 mentions)
Rt pcr kit, by Takara Bio (1 mentions)
Abi 7500ht real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr green qpcr supermix, by Roche (1 mentions)
Thermoscript rt pcr kit, by Thermo Fisher Scientific (1 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Oligo dt primer, by Promega (1 mentions)
Qiaamp dna mini kit, by Qiagen (1 mentions)
Genelute total rna purification kit, by Merck Group (1 mentions)
Sybr green quantitative kit, by Merck Group (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
Gene expression master mix, by Thermo Fisher Scientific (1 mentions)
Oligo dt primer, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Quantitect sybr green pcr master mix, by Qiagen (1 mentions)
Maxwell csc blood dna kit, by Promega (1 mentions)
Maxwell csc instrument, by Promega (1 mentions)
Prism v6, by GraphPad (1 mentions)
Stata se 14.1 for windows, by StataCorp (1 mentions)
10 protocols using 7500 real time pcr system software
1
qRT-PCR Analysis of Cell Gene Expression
2
Gene Expression Analysis Using qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIZOL reagent (Invitrogen) in accordance with the manufacturer’s instructions, and the first-strand cDNA was synthesised with the Thermo Script RT–PCR kit (Invitrogen) in accordance with the manufacturer’s instructions. Applied Biosystems 7500 Real-Time PCR system software was used for real-time PCR analysis. The analysis was performed with SYBR-green I fluorescence (Applied Biosystems). Quantification of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA (as an internal control for gene expression in the cells) was performed with TaqMan Human GAPDH Control Reagents (with VIC Probe, Applied Biosystems). For semi-qRT–PCR analysis, RT–PCR was performed with a Platinum qRT–PCR kit (Invitrogen) in accordance with the manufacturer’s instructions. PCR products were separated on 1.5% agarose gel. The primers used in this study were as follows: ABRO1-forward-primer: 5′-TCCATAACCATCAGCCTTGTTC-3′; ABRO1-reverse-primer: 5′-CCCAATGACTTTCTTTCTCCGA-3′; GAPDH-forward-primer: 5′-GGAGCGAGATCCCTCCAAAAT-3′; GAPDH-reverse-primer: 5′-GGCTGTTGTCATACTTCTCATGG-3′; p53-forward -primer: 5′-CAGCACATGACGG AGGTTGT-3′; p53-reverse-primer: 5′-TCATCCAAATA CTCCACACGC-3′; p21-forward-primer: 5′-TGTCCGTCAGAACCCATGC-3′; p21-reverse-primer: 5′-AAAGTCGAAGTTCCATCGCTC-3′; Mdm2-forward-primer: 5′-GAATCATCGGACTC AGGTACATC-3′; and Mdm2-reverse-primer: 5′-TCTGTCTCACTAATTGCTCTCCT-3′.
3
Reverse Transcription and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Complement DNA (cDNA) was synthesized by M-MLV reverse transcriptase (Invitrogen), oligo-dT primers (Promega, Madison, WA, USA), and extracted RNA. Specific sequences were amplified from each cDNA sample using a SYBR Green PR Master Mix (Applied Biosystems, Foster City, CA, USA) and the primers sequences listed in Supplementary Data. 5 . Relative expression was calculated by normalizing against 18 S mRNA expression on a 7500 Real-Time PCR System Software (v2.0.6, Applied Biosystems).
4
Quantifying IDLV DNA Vector Genomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The IDLV DNA vector genomes in transduced cells were determined as follows: the transduced cells were lysed after three days in culture and genomic DNA was extracted using the QiAamp DNA Mini Kit (Qiagen). 60 ng of genomic DNA was submitted to quantitative PCR using ΔU3 Fw and PBS Rev primer pairs (See Figure S1 ), which enabled us to discriminate viral vector genomes from total IDLV DNA. The orientation of DU3Fw and PBS Rev only the PCR amplification of the reverse transcribed viral genome. On the other hand, the primers were appropriately designed to amplify the same amplicon in the case of the incorporation or not of the genetic element into the TLRs (See SUP3). As an internal control, we used primers for the human albumin locus (hAlb). The DNA of transduced cells was extracted 72 h after transduction using a QiAamp DNA Mini Kit (QIAGEN, Hilden, Germany); Applied Biosystems 7500 Real-Time PCR System software was used to carry out the reactions. Each sample was analysed in triplicate. The PCR reaction consisted of 40 cycles at 95 °C for 3 s and at 62 °C for 30 s, followed by the melting curve.
5
Quantifying lncRNA SRLR Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For real‐time quantitative PCR (qRT‐PCR) analysis, total RNA was isolated using the GenElute total RNA purification kit (Sigma Aldrich) according to the manufacturer's protocol. A NanoDrop 2000c was used to measure RNA purity and concentration, then cDNA was prepared using the Applied Biosystems large‐capacity DNA reverse transcription kit. The SYBR green quantitative kit (Sigma‐Aldrich) was used for qRT‐PCR with GAPDH as the internal reference gene. The target gene lncRNA SRLR primers were designed and purchased from the Shanghai Sanggong Company. Threshold cycle (Ct) values were determined by the Applied Biosystems 7500 real‐time PCR system software.
6
Validating Microarray Gene Expression
7
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol (Life Technologies, Thermo Fisher). Complementary DNA (cDNA) was prepared from total RNA using M-MLV Reverse Transcriptase and oligo-dT primers (Invitrogen). Quantitative real-time PCR was performed using cDNA, QuantiTect SYBR Green PCR Master Mix (QIAGEN, Hilden, Germany), and specific primers. Primers used in this study are described in Supplementary Table 1 . Relative expression was calculated by normalizing against 18S ribosomal RNA on a 7500 Real-Time PCR System Software (v2.0.6, Applied Biosystems, Thermo Fisher).
8
Identification of CYP2C19 Extensive Metabolizers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To identify CYP2C19 extensive metabolizers, DNA was extracted from whole blood using a Maxwell® CSC Blood DNA Kit and Maxwell® CSC Instrument (Promega, Madison, WI, USA), and TaqMan allelic discrimination assays were performed in a real-time polymerase chain reaction (PCR) System (Applied Biosystems, Foster City, CA, USA). A 10-µL PCR mixture was prepared with 5 µL of 2× TaqMan Universal Master Mix II, 0.5 µL of 20× Drug Metabolism Genotyping Assay Mix, 3.5 µL of DNase-free water, and 1 µL of DNA. Genotyping for the CYP2C19*2 allele (rs4244285, assay ID: C__25986767_70) and CYP2C19*3 allele (rs4986893, assay ID: C__27861809_10) was performed using validated TaqMan Genotyping Assays. The PCRs were carried out in the order of initial denaturation at 95 °C for 10 min followed by 40 cycles of denaturation at 95 °C for 15 seconds and annealing/extension at 60 °C for 1 minute. The allelic discrimination results were determined using 7500 Real-Time PCR System software version 2.0.6 (Applied Biosystems, Foster City, CA, USA). Based on the genotyping results, only CYP2C19 extensive metabolizers carrying the CYP2C19 *1/*1 diplotype were included in the study.
9
Gene Expression Analysis of Cultured Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We extracted total RNA from cultured cells using TRIzol. After measuring RNA concentrations and confirming their purities, we used 1 μg RNA for reverse transcription to produce cDNA. We added cDNA samples to SYBR Green mixes for real-time PCR reactions (Table 1 ). qPCR reactions had final volumes of 20 μL containing 1 μL of the cDNA product, 1 μL upstream primer, 1 μL downstream primer, ddH2O 7 μL, and 10 μL 2x Master mix. We used the Applied Biosystems 7500 Real Time-PCR system software to analyze qRT-PCR amplification products. We compared the expression levels of RORγt, IL-6R, IL-23R, LIF, LIFR between groups after normalizing their levels with the level of the gapdh housekeeping gene. Though we aimed to collect results from all participants, some samples did not have enough volume to run qPCR for all target genes. Therefore, the number of participants for some qPCRs were less than the total sample size.
Sequences of the Primers for qRT-PCR
| Gene | Primer Sequences (5ʹ-3ʹ) |
|---|---|
| ROR | Forward: TGTCCCGAGATGCTGTCAAGT |
| GAPDH | Forward: GCCAGTAGACTCCACGACAT |
| LIFR | Forward: CCCCAAATAATGTTGAGGTTCTG |
| IL-6R | Forward: CCTGCCAACATCACAGTCACTG |
| IL-23R | Forward: CAAGAAACAGGCAAAAGGTA |
| LIF | Forward: CAGCATCACTGAATCACAGAGC |
10
Analyzing miR-16 Expression in NSCLC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For patient samples, normality distribution of the miR-16 expression value was tested using the Shapiro–Wilk test. The association between the miR-16 expression and type of tissue, normal (N) or tumoral (T), sample was assessed by the Wilcoxon matched-pairs signed-rank test. The same test was applied to the KRAS wild-type and KRAS-mutated NSCLC subgroups. Among the tumoral samples, the associations between the type of mutation and miR-16 expression values were assessed by the two-sample Mann–Whitney test. Box plots were presented on a log scale. A p-value of 0.05 was adopted for all statistical analyses. The statistical analyses were carried out with STATA/SE 14.1 for Windows (Stata Corp LP, College Station, TX, USA).
Data from the qRT-PCR analysis were analyzed with Applied Biosystems 7500 Real-Time PCR System Software, while the relative expression levels were calculated using the comparative Ct method (ΔΔCt), as described by Livak and Schmittgen [51 (link)]. The results obtained from all the experiments were analyzed with GraphPad Prism v.6.01 Software and were expressed as the mean ± standard deviation (SD). Differences between the groups were estimated using Prism GraphPad v.6.01 Software, and a maximum probability level of 0.05 was chosen for statistical significance.
Data from the qRT-PCR analysis were analyzed with Applied Biosystems 7500 Real-Time PCR System Software, while the relative expression levels were calculated using the comparative Ct method (ΔΔCt), as described by Livak and Schmittgen [51 (link)]. The results obtained from all the experiments were analyzed with GraphPad Prism v.6.01 Software and were expressed as the mean ± standard deviation (SD). Differences between the groups were estimated using Prism GraphPad v.6.01 Software, and a maximum probability level of 0.05 was chosen for statistical significance.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!