High pure pcr template preparation kit

Manufactured by Qiagen

Sourced in Germany

The High Pure PCR Template Preparation Kit is a lab equipment product designed for the extraction and purification of nucleic acids from a variety of sample types. It utilizes a silica-based membrane technology to efficiently capture and purify DNA or RNA, making it suitable for downstream applications such as PCR amplification.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop, by Thermo Fisher Scientific (2 mentions) Dneasy ultraclean microbial kit, by Qiagen (1 mentions) G box chemi xrq, by Syngene (1 mentions)

6 protocols using high pure pcr template preparation kit

Microbial DNA Extraction and H. pylori Identification

Check if the same lab product or an alternative is used in the 5 most similar protocols

a)
DNA extractionCommercial microbial DNA isolation kits were used to extract DNA from both the biopsy samples (Roche high pure PCR Template Preparation Kit, Mannheim, Germany) and the
H. pyloriisolates obtained from culture (DNeasy UltraClean Microbial Kit, Qiagen, Hilden, Germany). The extraction procedures were performed in accordance with the manufacturer’s instructions.
b)
Polymerase chain reaction (PCR)The PCR method was used to demonstrate the presence of
H. pyloriin the gastric biopsy specimens and to confirm the identification of the isolates recovered from the selective agar as
H. pyloriby phenotypic tests. For this purpose, primers (glmM-F 5’-AAGCTTTTAGGGGTGTTAGGGGTTT-3’ and glmM-R 5’-AAGCTTACTTTCTAACACTAAC GC-3’) specific to the phosphoglucosamine mutase (glmM) gene of
H. pyloriwere used, and the test was performed by a method of Lu et al. [18]. The amplification cycles consisted of denaturation at 93 °C for 1 min, primer annealing at 58 °C for 1 min, and extension at 72 °C for 1 min. Samples were amplified through 35 cycles. Amplified products were resolved by gel electrophoresis on 1.5% agarose (Biomax, Agarose, Lot no. 124543PR, from Prona, European Economic Community) and visualized under a UV transilluminator (G:BOX Chemi XRQ; Syngene, Cambridge, UK). Bands, which were 294-bp in size, were considered as a positive result.

AKAR M., AYDIN F., KAYMAN T., ABAY S, & KARAKAYA E. (2021). Detection of Helicobacter pylori by invasive tests in adult dyspeptic patients and antibacterial resistance to six antibiotics, including rifampicin in Turkey. Is clarithromycin resistance rate decreasing?. Turkish Journal of Medical Sciences, 51(3), 1445-1464.

+ Open protocol

+ Expand

Biobank Protocol for DNA and RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

After informed consent was obtained from donors, 10 ml blood is drawn into anticoagulated tube to extract DNA and RNA.
The process of extraction was performed using calibrated instruments and standard protocols.
High Pure PCR Template Preparation Kit (QIAGEN, Germany) was used for DNA and RNA.
These genetic materials were frozen and saved in −70°C. To prevent any contamination, DNA samples were aliquoted and stored at two different sites.[12 (link)]
As cDNA is more stable than RNA, cDNA was synthesized with reverse transcriptase enzyme and kept at −20°C. All experiments were made by a trained team of general physicians, researcher, nurses, and technicians. Specimens are coded according to each individual's code in biobank to ensure that anonymity is preserved.

Sherkat R., Rostami S., Yaran M., Emami M.H., Saneian H., Tavakoli H., Adibi P., Behnam M., Sheykhbahaei S., Bagherpour B., Khoshnevisan R, & Najafi S. (2018). Establishment and Development of the First Biobank of Inflammatory Bowel Disease, Suspected to Primary Immunodeficiency Diseases in Iran. Advanced Biomedical Research, 7, 45.

+ Open protocol

+ Expand

Whole-Genome Sequencing and Bioinformatic Analysis of Enterobacter Strain

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted by using the High Pure PCR Template Preparation Kit (Qiagen, Inc., Valencia, CA, United States). Whole-genome sequencing was subsequently performed by using Illumina HiSeq according to the 350-bp paired-end protocol available from Novogene Company (Beijing, China) and MinION in our lab. The genome was assembled de novo by using a Unicycler (Li et al., 2010 (link)). RAST 2.0 was used to annotate the genome sequences obtained (Aziz et al., 2008 (link)). ResFinder v3.2 was used to identify acquired antibiotic resistance genes (Jia et al., 2016 (link)). Plasmid replicon type was analyzed by using PlasmidFinder (Carattoli et al., 2014 (link)). IS sequences were analyzed by using ISfinder (Siguier et al., 2006 (link)). Sequences of pNDM1-CBG and three similar plasmids were compared by using BLAST and Easyfig software (Sullivan et al., 2011 (link)). Whole-genome sequences of CBG15936 were used to determine multilocus sequence typing (MLST) based on detection of seven housekeeping genes (arcA, aspC, clpX, dnaG, fadD, lysP, and mdh) in pubMLST¹ (Larsen et al., 2012 (link)). Twenty-nine sequences of the hsp60 gene of eight Enterobacter clusters were retrieved from NCBI and used for phylogenetic analysis to identify the species of the strain.

Chen Q., Lin Y., Li Z., Lu L., Li P., Wang K., Yang L., Ma H., Li P, & Song H. (2020). Characterization of a New Transposon, Tn6696, on a blaNDM–1-Carrying Plasmid From Multidrug-Resistant Enterobacter cloacae ssp. dissolvens in China. Frontiers in Microbiology, 11, 525479.

+ Open protocol

+ Expand

Genomic DNA Extraction from MRSA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from pure colonies of MRSA strains using the high pure PCR template preparation kit (QIAGEN, Germany) according to the manufacturer’s procedure. The concentration of extracted DNA was measured at 260 nm, using a Nanodrop instrument (Thermo Scientific, USA) and gel electrophoresis. The samples were stored at −20°C until PCR amplification.

Moosavian M., Baratian Dehkordi P, & Hashemzadeh M. (2020). Characterization of SCCmec, Spa Types and Multidrug Resistant of Methicillin-Resistant Staphylococcus aureus Isolates in Ahvaz, Iran. Infection and Drug Resistance, 13, 1033-1044.

+ Open protocol

+ Expand

Mitochondrial Cox1 Gene Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protoscoleces obtained from cysts were washed with distilled water and ethanol before they were centrifuged. Genomic DNA (gDNA) was then extracted using a High Pure PCR Template Preparation Kit (Qiagen GmbH, Hilden, Germany, Cat. No.51304).The mitochondrial cox1 gene was amplified with the reverse primer 5’-TAAAGAAAGAACATAATGAAAATG-3’[6 (link)] and the forward primer 5’- TTTTTTGGGCATCCTGAGGTTTAT-3’in a 40-μl reaction mixture containing 8 μl of master mix, 25.6 μl of deoxynucleotides (dNTPs), 2.4 μl of primers and 4 μl of DNA template. The PCR program consisted of an initial denaturation step at 94°C for 5 minutes, followed by 40 cycles of denaturation at 94°C for 45 seconds, annealing at 50°C for 45 seconds, and extension at 72°C for 10 minutes, and a final extension step at 72°C for 10 minutes. The PCR products were analyzed by 1% agarose gel electrophoresis.

Metwally D.M., Qassim L.E., Al-Turaiki I.M., Almeer R.S, & El-Khadragy M.F. (2018). Gene-based molecular analysis of COX1 in Echinococcus granulosus cysts isolated from naturally infected livestock in Riyadh, Saudi Arabia. PLoS ONE, 13(4), e0195016.

+ Open protocol

+ Expand

Molecular Identification of Parasitic Worms

Check if the same lab product or an alternative is used in the 5 most similar protocols

Worms obtained from mice and rats were washed with distilled water and ethanol before they were centrifuged. Genomic DNA (gDNA) was then extracted using a High Pure PCR Template Preparation Kit (Qiagen GmbH, Hilden, Germany Cat. No.51304). Amplification of cox1 and pnad5 was performed using specific primers (cox1: F:5′ AGAGTGATCCGGTGATATGGTGA 3′ R:5′ ACCATTCACCCTTGGTATAAGCAGA 3′, pnad5: F:5′ GAAGCGTTAATTATGGGTT 3′ R:5′ GATTACAAGTTGATAGAGCCC 3′) [14 (link)] in a 40 μl reaction mixture containing 8 μl of master mix, 25.6 μl of deoxynucleotides (dNTPs), 2.4 μl of primers, and 4 μl of DNA template. The PCR program consisted of an initial denaturation step at 94°C for 5 min followed by 40 cycles of denaturation at 94°C for 45 s, annealing at 50°C for 45 s, extension at 72°C for 10 min, and a final extension step at 72°C for 10 min. PCR products were analyzed via 1% agarose gel electrophoresis.

Metwally D.M., Al-Enezy H.A., Al-Turaiki I.M., El-Khadragy M.F., Yehia H.M, & Al-Otaibi T.T. (2019). Gene-based molecular characterization of cox1 and pnad5 in Hymenolepis nana isolated from naturally infected mice and rats in Saudi Arabia. Bioscience Reports, 39(2), BSR20181224.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!