Abi 3730 capillary sequencer with bigdye terminator cycle sequencing ready reaction kit v 3

The UltraClean^® Microbial DNA Isolation Kit (MO BIO Laboratories, Carlsbad, CA, USA) was used for genomic DNA preparation from C. necator H16. After separation of PCR amplified products by agarose gel electrophoresis, DNA fragments were excised from the gel and extracted using the Wizard SV Gel and PCR Clean-up system kit (Promega, Sunnyvale, CA, USA) following the manufacturer’s protocol. The same kit was also used for clean-up of the pJQ200mp18 vector following the restriction enzyme digestion. The Wizard^® Plus SV Minipreps DNA Purification System (Promega, Sunnyvale, CA, USA) was used to isolate plasmids from microorganisms according to the manufacturer’s instruction. For DNA amplification, 2X PCR Master Mix (Promega, Sunnyvale, CA, USA) was used. For proof-reading PCR, Phusion™ High-Fidelity DNA Polymerase (Finnzymes, Espoo, Finland) was used with 5x Phusion HF Buffer supplied. The cycling conditions vary depending on the purpose. The ABI 3730 Capillary Sequencer with BigDye™ Terminator Cycle Sequencing Ready Reaction kit v.3.1 (Applied Biosystems) was used for sequencing PCR of cloned insert DNA according to the manufacturer’s instructions.

Total RNA for RT‐PCR from Dhb sp. UNSWDHB grown in the absence and presence of CF was isolated using RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions, including on‐column DNase digestion with the QIAGEN RNase‐Free DNase Set. The cDNA was synthesized from total RNA using the SuperScript VILO MasterMix kit (Life Technologies, Carlsbad, CA, USA), according to the manufacturer's protocol. Equivalent amounts of RNA (100 ng) from each sample were subjected to RT reaction. A No‐RT control was run with DEPC‐treated water instead of template RNA. The primers specifically designed for tmrA gene (NCBI GI number: 530294411), tmrA_F (5′‐TTTGCCCAGATTGGATATG‐3′) and tmrA_R (5′‐CTTCACAGAGTCTAACATTTG‐3′), were used in PCR reactions where annealing temperature of 57.6°C was applied. A no template control (NTC), replacing the template cDNA with DEPC‐treated water and a no‐RT were included as negative controls. For DNA amplification, 2× PCR Master Mix (Promega, USA) was used. The PCR products were separated via electrophoresis in a 1.8% (w/v) agarose gel and were subsequently cleaned up using DNA Clean & Concentrator‐5 kit (Zymo Research) with subsequent verification by sequencing by the method of Sanger [13] using the ABI 3730 Capillary Sequencer with BigDye™ Terminator Cycle Sequencing Ready Reaction kit v.3.1 (Applied Biosystems, Foster City, CA, USA).