Anti mir 29c

Small interfering RNA (siRNA) targeting MEG3 (si-MEG3, 5’-GGAUGGCACUUGACCUAGA-3’), siRNA targeting AKAP12 (si-AKAP12, 5’-AGGUUAGUCACGCCAAGAA-3’), and the siRNA control (si-con) were purchased from Ribobio (Guangzhou, China). Also, the overexpression vector of MEG3 (MEG3) and its blank control (pcDNA) were obtained from Ribobio. All the oligonucleotides, including miR-29c mimic (miR-29c), miR-29c inhibitor (anti-miR-29c), and their relative controls (miR-con and anti-miR-con), were purchased from GenePharma (Shanghai, China). Transient transfection was carried out using Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) as per the manuals.

RP11-79H23.3 siRNA was obtained from RiboBio company (Guangzhou, China), while miR-29c mimics and Anti-miR-29c from GenePharma (Shanghai, China). The synthetic RP11-79H23.3 siRNA (20 nM), miR-29c mimics (50 nM), and Anti-miR-29c (50 nM) were mixed with Lipofectamine 2000 (Invitrogen, Shanghai, China) and added into the cell medium according to the instructions of manufacturer. After transfection for 48 h, both RNA and protein samples were extracted for further analysis. The siRNA, miRNA mimics and inhibitor (Anti-miR-29c) sequences applied in the study were as follows: RP11-79H23.3 siRNA-1: GTAACCCTTTCATGTCATT; RP11-79H23.3 siRNA-2: GTTCTCACATCGCTAACAA; RP11-79H23.3 siRNA-3: CCTATTTCTTACCATCCTT; RP11-79H23.3 siRNA-4: ATGACTTCCCTCTCCTAAGT; RP11-79H23.3 siRNA-5: ATATGTGATTCTCAGACCTC; RP11-79H23.3 siRNA-6: TTGGATCCCTAAGTAACTGA. miR-29c mimics: 5′-UAGCACCAUUUGAAAUCGGUUA-3′, 5′-ACCGAUUUCAAAUGGUGCUAUU-3′; Anti-miR-29c: 5′-UAACCGAUUUCAAAUGGUGCUA-3′.