Genomic DNA was isolated from sorted nuclei using phenol/chlorophorm and fragmented by Covaris. Library preparation of genomic DNA fragments was performed using the NEXTflex Bisulfite Sequencing kit (Bioo Scientific) and the EZ DNA Methylation-Gold Kit (Zymo) following manufacturer instructions. Amplified fragments of 340-360 bp were size selected by gel extraction and sequenced on a Illumina HiSeq 2500 instrument. Whole genome bisulfite sequencing of the unsynchronized cell culture derived from the T87 cell line was performed by BGI Genomics (Hong Kong). Genomic DNA was fragmented to 100-300 bp by sonication, end-repaired, and ligated to methylated adaptors. Bisulfite treatment was then performed using the EZ DNA Methylation-Gold Kit (Zymo), and the bisulfite-treated fragments were PCR amplified and sequenced as paired-end 150 bp reads (PE150) with Illumina technology.
Ez dna methylation gold kit
Manufactured by Zymo Research
Sourced in United States, Germany, China, Italy, Canada, United Kingdom, Australia, Netherlands
The EZ DNA Methylation-Gold Kit is a product offered by Zymo Research for bisulfite conversion of DNA samples. It is designed to convert unmethylated cytosine residues to uracil, while leaving methylated cytosines unchanged, enabling the detection and analysis of DNA methylation patterns.
Automatically generated - may contain errors
Lab products found in correlation
Qiaamp dna mini kit, by Qiagen (95 mentions)
Pgem t easy vector, by Promega (56 mentions)
Dneasy blood tissue kit, by Qiagen (51 mentions)
Dneasy blood and tissue kit, by Qiagen (43 mentions)
Pyromark pcr kit, by Qiagen (30 mentions)
Pyromark q24, by Qiagen (29 mentions)
Qiaquick gel extraction kit, by Qiagen (29 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (23 mentions)
Hiseq 2500, by Illumina (21 mentions)
Qiaamp dna ffpe tissue kit, by Qiagen (21 mentions)
Dneasy plant mini kit, by Qiagen (21 mentions)
Infinium humanmethylation450 beadchip, by Illumina (21 mentions)
Topo ta cloning kit, by Thermo Fisher Scientific (19 mentions)
Tianamp genomic dna kit, by Tiangen Biotech (19 mentions)
Wizard genomic dna purification kit, by Promega (19 mentions)
Pmd19 t vector, by Takara Bio (19 mentions)
Accel ngs methyl seq dna library kit, by Integrated DNA Technologies (18 mentions)
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (18 mentions)
Novaseq 6000, by Illumina (17 mentions)
Zymotaq premix, by Zymo Research (17 mentions)
1 642 protocols using ez dna methylation gold kit
1
Whole-Genome Bisulfite Sequencing of T87 Cells
2
Confirming Differentially Methylated Regions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Differentially methylated regions (DMRs) identified through bisulfite sequencing were confirmed through pyrosequencing PCR on Qiagen’s Pyromark MD. Primers for the PCR reaction were designed using the Pyromark Assay Design software (S7 Table ). Extracted DNA samples were bisulfite converted using Zymo EZ DNA Methylation-Gold kits and protocol. Unmethylated and methylated controls were included for each primer set. Methylation measurements were averaged across duplicates then across experimental group.
3
Bisulfite Treatment Validation for DNA Methylation Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 1
Complementary strands of double-stranded DNA can be made non-complementary by bisulfite treatment, which converts the cytosine nucleotide to uracil, as illustrated in
Here, Qiagen Epitect Bisulfite conversion kits (Qiagen, CA) and Zymo Research EZ DNA Methylation Gold kits (Zymo Research, Zymo Research Corporation, CA) were used according to the manufacturer's specifications for bisulfite conversion. DNA from human HCC tissue samples were bisulfite-treated and tested with specific assays before and after bisulfite-treatment. A region on the constitutive gene, actin, was used for comparison by running assays that target the non-bisulfite treated DNA region and the bisulfite-treated DNA region (see
The comparison of the before and after bisulfite treatment on the actin gene reveals that bisulfite treatment recovery is high as per the manufacturers specifications, and reveals the suitability for use in BS-cccDNA assay described herein.
4
Quantifying PAX1 Methylation in Cervical Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cervical exfoliated cells were centrifuged and stored in phosphate-buffered saline at −20 °C until testing. Genomic DNA was extracted using standard protocols and converted to bisulfite form using the EZ DNA Methylation-Gold kits (Zymo Research, Irvine, CA, USA). Methylation-specific PCR was performed on the Light Cycler LC480 system (Roche Applied Science, Penzberg, Germany) to determine the methylation level of PAX1 according to the manufacturer’s instructions (Hoomya Ltd., Changsha, China). The type II collagen gene (COL2A) was used as an internal reference. The (delta Cp(ΔCp)ΔCp is the difference between the ΔCp values for PAX1 and COL2A. DNA methylation status was calculated based on the differences between the Cp values of the tested and referred genes: ΔCp = Cp target gene—Cp Col2A. A low ΔCp value indicated a high PAX1m level in the collected samples.
5
Bisulfite-Sequencing of DNA Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bisulfite treatment of genomic DNA was completed with EZ DNA Methylation Gold Kits (Zymo Research). The bisulfate-treated DNA was amplified by PCR with primers designed by MethPrimer of the LiLab. Then PCR products were subcloned into T-Easy vector(Promega). Eightclones randomly selected from each treatment group were sent for sequencing. Sequencing results were analyzed by BiQ analyzer. Primers used for bisulfite sequencing were listed in S1 Table .
6
Whole Genome Bisulfite Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from bone marrow using the TIANamp Blood DNA Kit (TIANGEN). DNA concentration and integrity were assessed by a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and agarose gel electrophoresis. Then, the genomic DNA samples were added with a certain proportion of negative control (lambda DNA) and randomly interrupted at 200–300 bp. The interrupted DNA fragments were repaired at the end; an A-tail was added and ligated to the sequencing adaptor with all cytosines methylated. After bisulfite treatment by EZ DNA Methylation Gold Kits (Zymo Research, Irvine, CA, USA), the unmethylated C turned into U, while the methylated C remained unchanged. Finally, after PCR amplification and product purification, the final libraries were sequenced on the Illumina NovaSeq 6000 platform (Illumina Inc., San Diego, CA, USA), and 150 bp paired-end reads were generated. The sequencing and analysis were conducted by OE Biotech Co., Ltd. (Shanghai, China).
7
Methylation Analysis of miR-532 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Methylation-specific PCR (MSP) was performed as previously reported [14 (link)]. Briefly, genomic DNA was isolated, converted using EZ DNA Methylation-Gold Kits (ZYMO RESEARCH), and subjected to MSP and routine PCRs using Titanium Taq PCR kit (Takara Bio) to analyze the methylation of miR-532 gene. PCR products were analyzed on 1% agarose gel electrophoresis, stained with ethidium bromide, and photographed using MyECL imager (Thermo Fisher Scientific). Primers were 5’-CTTTCTAATGACCTGCATGCC-3’ and 5’-AGACATGCTGTAATGAGAAGGTG-3’ for routine PCR and 5’-TTTTTTAATGATTTGTATGTT-3’ and 5’-AAACATACTATAATAAAAAAATA-3’ for MSP. These primers were targeted to the promoter region of miR-532 (from −70 to −370).
8
Methylation Analysis of POMC Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In all, 16 samples were analyzed by MS-PCR. Total DNA from paraffin-embedded tissues of parathyroid glands was extracted using the QIAamp DNA paraffin-embedded Tissue Kit (Qiagen), and genomic DNA was treated with bisulfite using the EZ DNA Methylation-Gold Kits (Zymo Research). All unmethylated cytosine residues in DNA were converted into uracil, with no influence on methylated cytosine. Specific primers for both methylated and unmethylated DNA sequences were used for the POMC promoter (Table 3 ). Subsequently, promoter methylation of the POMC gene was detected by MS-PCR. The amplification products were detected by 2% agarose gel electrophoresis, and PCR results were analyzed on a Gel Imager.
Primers for the POMC gene
| Primer name | Primer sequences | Product size |
|---|---|---|
| POMC-M-F | TAGTTTTTAAATAATGGGGAAATCG | 141 bp |
| POMC-M-R | AACAACCTCTAAAATCGTTAAAACG | |
| POMC-U-F | ATAGTTTTTAAATAATGGGGAAATTG | 140 bp |
| POMC-U-R | CAACCTCTAAAATCATTAAAACAAA |
9
Epigenetic Analysis of PAX1 Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PAX1 methylation was evaluated at the aforementioned time points. Cervical exfoliated cells were obtained by cervical brush during gynecological examination, centrifuged and stored in phosphate-buffered saline at -20°C. Genomic DNA was extracted using standard protocols, and converted to bisulfite form using the EZ DNA Methylation-Gold kits (Zymo Research, Irvine, CA, USA) according to the manufacturer's instructions. Methylation-specific PCR was performed on the Light Cycler LC480 system (Roche Applied Science, Penzberg, Germany) to determine the methylation level of PAX1. Type II collagen gene (COL2A) was used as an internal reference. The △Cp is the difference between the △Cp values for PAX1m and COL2A. The methylation level (△Cp) was assessed by the following formula: △Cp=Cptarget gene - CpCol2A12 (link). The smaller △Cp value denote a higher degree of methylation detected in the collected samples. Accordingly, if △Cp≤9 (the cut-off value), PAX1 was considered hypermethylated or positive. A decrease of △Cp value appeared indicating an increased methylation level 17 (link). The change in △Cp value (%) was calculated using the following equation: (post-treatment △Cp - pre-treatment △Cp) / pre-treatment △Cp × 100 (%).
10
Quantitative gene expression and protein analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time RT-PCR (qRT-PCR) and immunoblot analyses were performed following procedures as described previously [59 (link), 60 (link)]. Relative mRNA levels were determined using the comparative 2−ΔΔCT method and normalized against β-actin. The specificity of the primers was validated by the melting-curve detection. PCR cycle times ≥ 34 were considered to be below detection. For quantitative methylation-specific PCR (qMSP), bisulfite conversion method was used (EZ DNA Methylation-Gold Kits, Zymo Research), with the type II collagen gene (COL2A1) used as the internal reference gene. Primer sequence information is listed in the Supplementary Table S1 . For immunoblot analysis, a chemiluminescence method was used for immunosignal detection (Amersham ECL Western Blotting Detection System). Primary antibodies used are as follows: HNF4α (K9218, abcam), p21Waf1/Cip1 (12D1, Cell Signaling Technology), β-actin (C4, Santa Cruz Biotechnology), FLAG (M2, Sigma-Aldrich), p53 (sc-126, Santa Cruz Biotechnology), Rb (ab181616, abcam), and phospho-Rb (ab184796, abcam).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!