The RNA in CRC tissues and cells was extracted using TriQuick Reagent (Solarbio, Beijing, China), and AMV Reverse Transcriptase (Solarbio, Beijing, China) was used to perform reverse transcription. Then, the qPCR was carried out using SYBR Green PCR Master Mix (Ambion, Carlsbad, CA, USA). The levels of circ_0007142, DOCK1, and CDC25A were normalized by glyceraldehyde 3-phosphate dehydrogenase (GAPDH) while miR-122-5p was standardized by small nuclear RNA U6, then processed by the method of.−ΔΔCt17 (link) The sequences of primers were displayed as follows: circ_0007142: (F, 5ʹ-GAACTCTGCCTCAGGATGAA-3ʹ, and R, 5ʹ-AACGTGTAACCTCGGTACCA-3ʹ); DOCK1: (F, 5ʹ-CCGCCGCAAACTTTTTCCTC-3ʹ, and R, 5ʹ-AGATGTGCACAGTGTCTCCG-3ʹ); miR-122-5p: (F, 5ʹ-GGGGTGGAGTGTGACAATG-3ʹ, and 5ʹ-CAGTGCGTGTCGTGGAGT-3ʹ); CDC25A: (F, 5ʹ-TGACATCTTTCAGCTCATCG-3ʹ, and R, 5ʹ-CAGACAAAGTGGCTGTCACAG-3ʹ); GAPDH: (F, 5ʹ-TGTTCGTCATGGGTGTGAAC-3ʹ, and R, 5ʹ-ATGGCATGGACTGTGGTCAT-3ʹ), and U6: (F, 5ʹ-ATTGGAACGATACAGAGAAGATT-3ʹ, and R, 5ʹ-GGAACGCTTCACGAATTTG-3ʹ).
Amv reverse transcriptase
Manufactured by Solarbio
Sourced in China
AMV Reverse Transcriptase is an enzyme used in molecular biology experiments to synthesize complementary DNA (cDNA) from RNA templates. It catalyzes the conversion of single-stranded RNA into double-stranded cDNA, which can then be used in various downstream applications such as gene expression analysis and reverse transcription-PCR.
Automatically generated - may contain errors
Lab products found in correlation
Triquick reagent, by Solarbio (2 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Sybr premix ex taq 2, by Takara Bio (2 mentions)
Sybr green, by Takara Bio (1 mentions)
Trizol, by Takara Bio (1 mentions)
Miscript rt kit, by Takara Bio (1 mentions)
Taqman mirna assay, by Thermo Fisher Scientific (1 mentions)
Sybr green supermix kit, by Takara Bio (1 mentions)
Actinomycin d, by Solarbio (1 mentions)
Trizol reagent, by Solarbio (1 mentions)
M mlv reverse transcriptase, by Solarbio (1 mentions)
Sybr green, by Solarbio (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Tiangen Biotech (1 mentions)
Sybr green realtime pcr master mix, by Toyobo (1 mentions)
7 protocols using amv reverse transcriptase
1
Quantitative Analysis of CircRNA, mRNA, and miRNA Expressions in Colorectal Cancer
2
Quantification of PDL RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from periodontal ligament (PDL) tissues and cells was extracted with the help of TRIzol (TaKaRa, Dalian, China). Immediately afterwards, reverse transcription (RT) was executed adhering to the instructions of the AMV Reverse Transcriptase (Solarbio, Beijing, China) and miScript RT Kit (TaKaRa). The quantitative real-time polymerase chain reaction (qRT-PCR) with cDNA as template was carried out exactly as described in the SYBR Green (TaKaRa) instructions, and information on the primers used in this procedure was listed in Supplement Table 1 . We normalized to the qRT-PCR data by glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 small nuclear RNA (U6).
3
Quantitative Analysis of miR-21-3p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA from A549 cells was extracted using TriQuick Reagent (Solarbio). Then, the reverse transcription for genes was carried out using AMV Reverse Transcriptase (Solarbio), while TaqMan miRNA assays (Applied Biosystems, Carlsbad, CA, U.S.A.) was used for miR-21-3p. The universal primer Uni-12 was used to reverse transcribe the influenza genome. The quantitative PCR was performed using SYBR Green PCR Master Mix (Ambion, Carlsbad, CA, U.S.A.). The relative expression level of miR-21-3p was normalized by small nuclear RNA U6, while genes were normalized via glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and then calculated by the 2−ΔΔCt method. The primer sequences were shown in Table 2 .
4
Profiling Circular RNA and miRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was prepared using TRIzol reagent. Then, complementary DNAs (cDNAs) were synthesized using Geneseed® II First Strand cDNA Synthesis Kit with Random or Oligo(dT)18 primers, and the levels of circ_0092012 and PDL1 were detected using the SYBR® Green Supermix Kit (Takara, Dalian, China). Besides, the AMV Reverse Transcriptase (Solarbio, Beijing, China) and SYBR Premix Ex Taq II (TaKaRa) were employed for reverse transcription and qRT-PCR for miR-635. The relative gene expression was detected by the 2−ΔΔCt method [31 (link)]. The primers are listed in Table 1 . Actinomycin D (Solarbio) was employed to block the de novo RNA synthesis, followed by qRT-PCR analysis.
Primers sequences used for qRT-PCR.
| Name | Primers for qRT-PCR | ||
|---|---|---|---|
| circ_0092012 | Forward | TGGCACTTACAGCTGCTCCT | |
| Reverse | CTCTACCGTGCCCTTCTGTC | ||
| PDL1 | Forward | TTGCTGAACGCCCCATACAA | |
| Reverse | TCCAGATGACTTCGGCCTTG | ||
| miR-635 | Forward | GCCGAGACTTGGGCACTGAAACA | |
| Reverse | GTGCAGGGTCCGAGGT | ||
| GAPDH | Forward | GACAGTCAGCCGCATCTTCT | |
| Reverse | GCGCCCAATACGACCAAATC | ||
| U6 | Forward | CTCGCTTCGGCAGCACA | |
| Reverse | AACGCTTCACGAATTTGCGT | ||
| Name | Primers for RT-qPCR | ||
| miR-635 | GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACGGACAT | ||
5
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction was implemented as per the TRIzol reagent (Solarbio, Beijing, China) instructions. Complementary DNA (cDNA) was obtained by reverse transcription with AMV Reverse Transcriptase and M‐MLV Reverse Transcriptase (Solarbio). These cDNA were then quantified using SYBR Green (Solarbio). All primers were purchased from Sangon and the sequences were presented in Table 1 . The data were analyzed using the 2−ΔΔCt method with Homo sapiens actin β (β‐actin) and RNA U6 (U6) as a internal reference.
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated by Trizol reagent (TaKaRa, Tokyo, Japan). RNA concentrations and quality were detected with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, US). The AMV Reverse Transcriptase (Solarbio, Beijing, China) was adopted for reverse transcription of RNA into cDNA. SYBR Premix Ex Taq II (TaKaRa) was used for gene expression analysis. The results were collected and calculated using the 2−ΔΔCt method. U6 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were used as controls. The primers are shown in Table 2 .
7
Quantitative Analysis of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA in LSCC tissues and cells was acquired with the Trizol Reagent (TIANGEN, Beijing, China), and cDNA was compounded with AMV Reverse Transcriptase (Solarbio) and quantified by SYBR Green Realtime PCR Master Mix (Toyobo Co., Osaka, Japan). Glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) and small nuclear RNA (U6) were chosen as the internal steward genes, and relative RNA expression was calculated by the 2−ΔΔCt method. BGI (Beijing, China) was hired to synthesize primers, and the primer sequences were shown as follows:
circBFAR: 5′‐CCAAACCTCAAGAATGCAGGC‐3′ (sense), 5′‐CCCTGCTTCAGCAGTATCCA‐3′ (antisense);
COL5A1: 5′‐CTTGGCCCAAAGAAAACCCG‐3′ (sense), 5′‐GCGTCCACATAGGAGAGCAG‐3′ (antisense);
SPARC: 5′‐CATTGCACCACCCGCTTTTT‐3′ (sense), 5′‐GATATCCTTCTGCTTGATGCCG‐3′ (antisense);
miR‐31‐5p: 5′‐GTATGATCTTGGAGTAGGTCA‐3′ (sense), 5′‐CTCAACTGGTGTCGTGGAG‐3′ (antisense);
U6: 5′‐CTCGCTTCGGCAGCACA‐3′ (sense), 5′‐AACGCTTCACGAATTTGCGT‐3′ (antisense);
GAPDH: 5′‐GACAGTCAGCCGCATCTTCT‐3′ (sense), 5′‐GCGCCCAATACGACCAAATC‐3′ (antisense).
circBFAR: 5′‐CCAAACCTCAAGAATGCAGGC‐3′ (sense), 5′‐CCCTGCTTCAGCAGTATCCA‐3′ (antisense);
COL5A1: 5′‐CTTGGCCCAAAGAAAACCCG‐3′ (sense), 5′‐GCGTCCACATAGGAGAGCAG‐3′ (antisense);
SPARC: 5′‐CATTGCACCACCCGCTTTTT‐3′ (sense), 5′‐GATATCCTTCTGCTTGATGCCG‐3′ (antisense);
miR‐31‐5p: 5′‐GTATGATCTTGGAGTAGGTCA‐3′ (sense), 5′‐CTCAACTGGTGTCGTGGAG‐3′ (antisense);
U6: 5′‐CTCGCTTCGGCAGCACA‐3′ (sense), 5′‐AACGCTTCACGAATTTGCGT‐3′ (antisense);
GAPDH: 5′‐GACAGTCAGCCGCATCTTCT‐3′ (sense), 5′‐GCGCCCAATACGACCAAATC‐3′ (antisense).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!