Total RNA was extracted from the cells using TRIzol (Takara Biotechnology Co., Ltd.) according to the manufacturer's protocol. cDNA was synthesized using the GoScript Reverse Transcription System (Promega Corporation) and 1 µg of RNA according to the manufacturer's protocol. qPCR was performed using a SYBR Green PCR kit (Bimake.com) according to the manufacturer's instructions on an Applied Biosystems QuantStudio instrument (Thermo Fisher Scientific, Inc.). Comparative quantification was performed using the 2−ΔΔCq (30 (link)) method with GAPDH as the endogenous control, The PCR system was 20 µl, and the thermocycling conditions were as follows: 40 cycles were operated at 95°C for 3 min, 95°C for 15 sec and 60°C for 1 min. The dissolution curve program was as follows: 95°C for 15 sec, 60°C for 1 min, and 95°C for 1 sec. The primer sequences were as follows: CDC45 forward, 5′-TTCGTGTCCGATTTCCGCAAA-3′ and reverse, 5′-TGGAACCAGCGTATATTGCAC-3′; GAPDH forward, 5′-GGAGCGAGATCCCTCCAAAAT-3′ and reverse, 5′-GGCTGTTGTCATACTTCTCATGG-3′.
Applied biosystems quantstudio instrument
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Applied Biosystems QuantStudio instrument is a real-time PCR system designed for quantitative gene expression analysis, genotyping, and other molecular biology applications. The instrument uses thermal cycling technology to amplify and detect nucleic acid sequences in samples. It features a high-performance optical system and advanced software for data analysis and reporting.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Takara Bio (2 mentions)
Goscript reverse transcription system, by Promega (2 mentions)
Tb green premix ex taqtm kit, by Takara Bio (2 mentions)
Sybr green pcr kit, by Selleck Chemicals (1 mentions)
Formaldehyde solution, by Merck Group (1 mentions)
Chip assay kit, by Beyotime (1 mentions)
Glycine, by Sangon (1 mentions)
Hiscript 2 q rt supermix, by Vazyme (1 mentions)
Gapdh primer, by Sangon (1 mentions)
Biometra tone, by Analytik Jena (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Chamq universal sybr qpcr master mix, by Vazyme (1 mentions)
Primescript rt master mix reagents, by Takara Bio (1 mentions)
Rnaiso plus, by Takara Bio (1 mentions)
5 protocols using applied biosystems quantstudio instrument
1
Quantitative RT-PCR Analysis of CDC45 Expression
2
Quantification of miRNA Expression by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cells by TRIzol (TaKaRA, China) according to the manufacturer’s protocol. cDNA was synthesized using the GoScript Reverse Transcription System (Promega, Wisconsin, USA) and 1 µg of RNA as described by the manufacturer. qPCR was performed using a SYBR Green PCR kit (Biomake, Houston, USA) according to the manufacturer’s instructions on an Applied Biosystems QuantStudio instrument (Thermo Fisher Scientific, Massachusetts, USA). Comparative quantification was performed using the 2DCt method with GAPDH/U6 as the endogenous control. The primer sequences were in Table S2 Table S3
3
Chromatin Immunoprecipitation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were cross-linked with 1% Formaldehyde Solution (Sigma-Aldrich) for 15 min at 37 °C, quenched by 125 mM Glycine (Sangon Biotech, Shanghai, China) for 5 min at room temperature, and sonicated to shear DNA. CHIP assay was performed with CHIP Assay Kit (Beyotime) according to the manufacturer’s protocol. Chromatin fragments were precipitated with anti-AR (#51533, CST, 1:100 dilution) or a control non-immune IgG (#7074, CST, 1:100 dilution). The precipitate was eluted and analyzed by QPCR using TB Green Premix Ex TaqTM kit (Taka ra) and the Applied Biosystems QuantStudio instrument (Thermo Fisher). The primers of CHIP-QPCR were listed in Table S2 .
4
Gene Expression Analysis of Extracellular Matrix Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cells were seeded at 1 × 105 cells/well into 6-well plates, and the medium was changed as described above. After 7 days, RNA was extracted by using TRIzol (Ambion, Austin, TX, USA) and a small total RNA extraction kit (Tianmobio, Beijing, China). HiScript Ⅱ Q RT SuperMix (Vazyme, Nanjing, China) and ChamQ Universal SYBR qPCR Master Mix (Vazyme) were used for reverse transcription PCR and real-time qPCR. All steps were performed according to the manufacturer's instructions. The sequences of the primers used are listed in Table 1 . Endogenous reference gene (GAPDH) primers were purchased from Sangon Biotech (Shanghai, China), which also synthesized the other primers. Reverse transcription PCR was performed using Biometra TOne (Analytik Jena, Jena, Germany). Real-time qPCR was performed using an Applied Biosystems QuantStudio instrument (Thermo Fisher Scientific). Relative quantification was calculated using 2-ΔΔCt.Table 1
Primer sequences.
| Gene name | Primer sequence (5′ -3′) | Product size (bp) | Transcript ID |
|---|---|---|---|
| SPP1 | F CTCCATTGACTCGAACGACTC | 230 | NM_001,251,830 |
| POSTN | F CTCATAGTCGTATCAGGGGTCG | 138 | NM_001,135,935 |
| COL-Ⅰ | F GAGGGCCAAGACGAAGACATC | 140 | NM_000088 |
5
Quantification of Gene Expression by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using RNAiso Plus (Takara). About 2 μg of purified RNA was reversely transcribed into cDNA by the PrimeScriptTM RT master mix reagents (Takara). Real-time quantitative PCR was performed with TB Green Premix Ex TaqTM kit (Takara) in Applied Biosystems QuantStudio instrument (Thermo Fisher). The real-time quantitative PCR reaction was conducted with the condition: 30 s at 95 °C, 40 cycles of 5 s at 95 °C, followed by 20 s at 60 °C. All the primers was synthesized by Sangon (Shanghai, China) and listed in Table S2 . The relative expression of genes was normalized by β-actin. The data were shown as –ΔΔCT.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!