Tissue culture treated microplates

Manufactured by Corning

Sourced in United Kingdom

Tissue-culture treated microplates are laboratory equipment designed for cell culture applications. They provide a specialized surface that promotes the attachment and growth of cells in vitro. The surface treatment enhances the adhesion and proliferation of various cell types, enabling researchers to conduct experiments and observations in a controlled environment.

Automatically generated - may contain errors

Lab products found in correlation

Caspase 3 7 green dye, by Sartorius (1 mentions) Incucyte basic software v2018a, by Sartorius (1 mentions) Camptothecin, by Merck Group (1 mentions) Phrodo red succinimidyl ester, by Thermo Fisher Scientific (1 mentions) T vector pmd20, by Takara Bio (1 mentions)

Close spelling variants of this product

96-well flat clear bottom polystyrene tissue-culture treated microplates (2 citations) White flat bottom polystyrene tissue-culture-treated microplates (2 citations)

3 protocols using tissue culture treated microplates

Real-time Tumor Cell Killing Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tumor killing was evaluated in real-time using the IncuCyte platform. Magnetic-bead-enriched CD3-CD56+ NK effector cells were plated into 96-well flat clear-bottom polystyrene tissue-culture-treated microplates (Corning, Flintshire, UK) along with NuclightRed stably expressing OVCAR8 cells at a 2:1 effector:target ratio. Caspase-3/7 green dye (Sartorious, Ann Arbor, MI, USA) was added to pick up dying cells that have not yet lost NuclightRed fluorescence. Noted treatments were then added at a 30 nM concentration, and the plate was placed in an IncuCyte ZOOM^® platform housed inside a cell incubator at 37 °C/5% CO₂. Images from three technical replicates were taken every 15 min for 48 h using a 4X objective lens and then analyzed using IncuCyte™ Basic Software v2018A (Sartorious). Graphed readouts represent percentage live OVCAR8 targets (NuclightRed⁺Caspase-3/7⁻), normalized to live targets alone at the starting (0 h) time point.

Vallera D.A., Ferrone S., Kodal B., Hinderlie P., Bendzick L., Ettestad B., Hallstrom C., Zorko N.A., Rao A., Fujioka N., Ryan C.J., Geller M.A., Miller J.S, & Felices M. (2020). NK-Cell-Mediated Targeting of Various Solid Tumors Using a B7-H3 Tri-Specific Killer Engager In Vitro and In Vivo. Cancers, 12(9), 2659.

+ Open protocol

+ Expand

Efferocytosis Assay for Peritoneal Macrophages

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peritoneal lavage was performed as described at the macrophage proteomics paragraph. After centrifugation and resuspension, 60,000 cells were seeded in quadruplets into 96-well flat clear-bottom black-walled polystyrene tissue-culture treated microplates (Corning, Glendale, Arizona) and incubated for 15 min at RT followed by 75 min at 37°C with 5% CO₂ to allow for adhesion. Next, nonadherent cells were washed away with PBS. Prior to efferocytosis experiments, Jurkat T cells were treated with 0.1 μmol/l camptothecin (Sigma-Aldrich) for 16 h to induce apoptosis (>80% annexin A5+ and <10% Viobility+) (Supplemental Figure S2). Subsequently, apoptotic cells were labelled with 80 ng/mL pHrodo Red, succinimidyl ester (Invitrogen, cat P36600) per 10⁶ cells for 30 min at RT, hidden from light, washed twice with PBS, and resuspended in RPMI. Next, 90,000 apoptotic Jurkat T cells were added per well (3:2 ratio, Jurkat T cells to macrophages) to peritoneal macrophages in RPMI. The efferocytic capacity of peritoneal macrophages was determined by using overlays of phase contrast and fluorescence images of cells for 2 h incubation in an IncuCyte ZOOM live-cell imaging and analysis platform (Essen BioScience).

Louwe M.C., Olsen M.B., Kaasbøll O.J., Yang K., Fosshaug L.E., Alfsnes K., Øgaard J.D., Rashidi A., Skulberg V.M., Yang M., de Miranda Fonseca D., Sharma A., Aronsen J.M., Schrumpf E., Ahmed M.S., Dahl C.P., Nyman T.A., Ueland T., Melum E., Halvorsen B.E., Bjørås M., Attramadal H., Sjaastad I., Aukrust P, & Yndestad A. (2020). Absence of NLRP3 Inflammasome in Hematopoietic Cells Reduces Adverse Remodeling After Experimental Myocardial Infarction. JACC: Basic to Translational Science, 5(12), 1210-1224.

+ Open protocol

+ Expand

C1s Gene Sequencing and CRISPR Knockout

Check if the same lab product or an alternative is used in the 5 most similar protocols

The C1s gene was sequenced and verified against the NCBI mRNA RefSeq XM_007646821.2 and protein RefSeq XP_007645011.1. Guide RNAs were cloned into the CRISPR Nuclease Vector (GeneArt, Thermo Fisher) and selected using CRISPy Cas9 target finder (Novo Nordisk, Technical University of Denmark): sgRNA1 GATAATCTCAGGAGGCGTCG, sgRNA2 GCCAGTAAACCGCTCTTCGT, sgRNA3 GGGCTCTTATTGACGAGTAC and sgRNA4 GTTGACAGCCGCTCATGTTG. To sequence indels, 0.5 × 10⁶ cells were spun down and boiled in 10 ul of milliQ water. 5 ul of cell lysate was used for PCR. For single cell cloning, cells were diluted to 0.5 cells/well in 96 well tissue-culture treated microplates (Corning, Corning, NY) and grown for 14–21 days at 37C, 8% CO₂ and 85% humidity. For scale-up protein production, media was supplemented at 10% of culture volume every 3 days with a feed consisting of Proyield Cotton CNE50M-UF (FrieslandCampina, Delhi, NY) and TC Yeastolate Ultra-Filtered (BD Biosciences, San Jose, CA). For blue-white screening, PCR products of the genetic knockout from clones was ligated into the T-Vector pMD20 (Takara Bio, Mountain View, CA). One Shot TOP10 Competent cells were transformed and plated in IPTG and XGal.

Li S., Yu B., Byrne G., Wright M., O’Rourke S., Mesa K, & Berman P.W. (2019). Identification and CRISPR/Cas9 Knockout of the Endogenous C1s Protease in CHO Cells Eliminates Aberrant Proteolysis of Recombinantly Expressed Proteins. Biotechnology and bioengineering, 116(9), 2130-2145.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!