Quant it picogreen dsdna reagent
The Quant-iT PicoGreen dsDNA reagent is a fluorescent dye used for the quantitation of double-stranded DNA (dsDNA) in solution. It provides a sensitive and accurate method for measuring dsDNA concentrations.
Lab products found in correlation
179 protocols using quant it picogreen dsdna reagent
Quantification of Deoxyribonucleic Acid
Quantification of Mitochondrial DNA Damage
Glutamate Uptake Assay in Cells
Quantification of Cell-Free DNA
Genotyping by Sequencing Protocol
Quantifying DNA and Alkaline Phosphatase
Amplicon Sequencing of Genomic DNA
FFPE Tissue DNA Extraction and Quantification
Assessing DNA Amplifiability in FFPE Samples
To assess the amplifiability of the DNA pairs, the following primers (Fw: 5′ GAGTTCGAGACCACCCTGGG and Rv : 5′AGAGTCTCACTCTGTAGCCCAA) were used amplify a 200 base pair fragment of a specific Alu family, AluSx_5 [38 (link)]. We chose to amplify this Alu subfamily because it is present in ∼400 copies throughout the genome, giving us a genome-wide view of amplifiability. Two ng of each DNA sample (FF and FFPE) was used per 10 μL qPCR reaction (SYBR Green Master Mix, Life Technologies) and compared to a standard curve of high quality human genomic DNA (CloneTech, Mountain View, CA). A Ct value was calculated for each sample in a FF/FFPE pair using Bio-Rad CFX software (Biorad, Hercules, CA). ΔCt values were calculated by calculating the difference between values for FFPE and corresponding FF samples (
Amplicon Sequencing for Genomic Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!