Purification of SUMO3 conjugates from HeLa cells stably expressing His-tagged SUMO3 was performed as previously described42 (link). Briefly, cells were seeded in 6-well plates and transfected with YFP-tagged FOXP2 variants or YFP alone. After 48 h cells were lysed in 6 M Guanidinium-HCl, 10 mM Tris, 100 mM Sodium phosphate buffer pH 8.0, 5 mM β-mercaptoethanol and 5 mM imidazole. An aliquot of the lysate (10%) was retained as the input sample and the remainder was incubated with His-tag Dynabeads (Life Technologies) overnight at 4 °C with rotation. Beads were washed with 8 M Urea, 10 mM Tris pH 6.3, 100 mM sodium phosphate buffer, 0.1% Triton x-1000 and 5 mM β-mercaptoethanol. SUMO3 conjugates were eluted by incubation at room temperature for 20 min in 200 mM imidazole, 150 mM Tris pH 8.0, 5% SDS, 30% glycerol, 720 mM β-mercaptoethanol and 0.0025% bromophenol blue. Western blotting was performed as described above; His-tagged SUMO3 conjugates were detected using an anti-His tag antibody (Abgent cat. no. AM1010a, 1:1000).
Dynabeads his tag
Manufactured by Thermo Fisher Scientific
Sourced in United Kingdom, United States
Dynabeads His-Tag is a magnetic bead-based affinity purification system designed for the rapid and efficient purification of His-tagged proteins from various sample matrices. The beads are coated with a chelating ligand that binds to the histidine tag on the target protein, allowing for easy separation and recovery using a magnet.
Automatically generated - may contain errors
Lab products found in correlation
Lsr 2 flow cytometer, by BD (4 mentions)
Alexa fluor nhs ester kit, by Thermo Fisher Scientific (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (2 mentions)
Apex antibody labeling kit, by Thermo Fisher Scientific (2 mentions)
Facscanto 2, by BD (2 mentions)
Ampure xp bead, by Beckman Coulter (1 mentions)
Phosphate buffered saline (pbs), by Lonza (1 mentions)
Dynamag 2 magnet, by Thermo Fisher Scientific (1 mentions)
Recombinant human ace2 protein, by R&D Systems (1 mentions)
Dnase 1, by New England Biolabs (1 mentions)
M per, by Thermo Fisher Scientific (1 mentions)
Dynabead, by Thermo Fisher Scientific (1 mentions)
Protein g sepharose, by Merck Group (1 mentions)
Anti flag m2 affinity agarose gel, by Merck Group (1 mentions)
Anti α tubulin antibody, by Merck Group (1 mentions)
Horseradish peroxidase conjugated goat anti rabbit igg, by GE Healthcare (1 mentions)
Dynabeads protein g, by Thermo Fisher Scientific (1 mentions)
Mouse monoclonal anti flag m2, by Merck Group (1 mentions)
Recombinant rat neural agrin, by R&D Systems (1 mentions)
28 protocols using dynabeads his tag
1
Purification of SUMO3 Conjugates from HeLa Cells
2
MinION Nanopore Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Amplified cDNA from Round B was purified using AMPure XP beads (Beckman Coulter, Brea, CA), and 1 μg DNA was used as input into Oxford Nanopore Genomic DNA MAP-003 Kits (Chik1, Ebola1) or MAP-004 Kits (HepC1, Ebola2) for generation of MinION Oxford Nanopore-compatible libraries [9 (link), 11 (link)]. Briefly, the steps include: (1) addition of control lambda phage DNA, (2) end-repair with the NEBNext End Repair Module, (3) 1× AMPure purification, (4) dA-tailing with the NEBNext dA-tailing Module, (5) ligation to protein-linked adapters HP/AMP (Oxford Nanopore Technologies, Oxford, UK) using the NEBNext QuickLigation Module for 10 min at room temperature, (6) purification of ligated libraries using magnetic His-Tag Dynabeads (Life Technologies), and (7) elution in 25 μL buffer (Oxford Nanopore Technologies). Lambda phage DNA was not added during preparation of the Ebola2 sample library.
3
Crosslinking and Pull-down of His-Fin
4
Denaturing Pulldowns of Hrd1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Denaturing pulldowns of Hrd1 were performed as described previously (Baldridge and Rapoport, 2016 (link)) with the following modifications. Cells with a centromeric plasmid bearing an endogenous Hrd1 promoter and a Hrd1-His10 were grown to mid-log phase and lysed in 50 mM HEPES pH 7.4, 300 mM KCl, protease inhibitors, 1 mM PMSF, 1.5 µM pepstatin, 8M urea (to prevent additional Hrd1 autoubiquitination), and 5 mM NEM (to inhibit deubiquitinating enzymes). The lysates were centrifuged at 2000 x g for 10 min, and the supernatant was collected and re-centrifuged for 30 min in a Ti45 rotor at 42,000 rpm (RCFavg 138,001). The membranes were solubilized in 50 mM HEPES pH 7.4, 300 mM KCl, protease inhibitors, 1 mM PMSF, 6M urea, 1.5% Triton X-100 final and 25 mM imidazole) for 1 hr at 4°C. His-tag Dynabeads (Life Technologies) were added (0.25 mL per 1,500 OD cells) and incubated for an additional 1 hr. The beads were washed three times with a 30-fold excess buffer. Hrd1-His10 was eluted with buffer including 400 mM imidazole. The samples were analyzed by SDS-PAGE and immunoblotting with anti-Hrd1 and anti-ubiquitin antibodies (clone P4D1, Santa Cruz). Unbound IMAC flow-through was used for a loading control to demonstrate equal material input.
5
Multiplexed Nanopore Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Barcodes were added to the PCR amplicons with Oxford Nanopore primers complementary to the tail sequence with a sample specific barcode (Barcode Developer Kit I) using Long Range PCR kits (NEB) (Fig. 1 ). This allowed for multiplexing of up to 12 samples on a single flow cell. Barcoded PCR libraries were quantified with Qubit dsDNA HS Assay kit, normalized, and pooled to a final amount of 1 μg. For sequencing, the libraries were end-repaired and dA-tailed using NEB DNA Ultra modules, followed by the ligation of hairpin and Oxford Nanopore-specific leader adapters using Genomic DNA Sequencing Kit MAP-004 (Oxford Nanopore). A motor protein was bound to both the leader and hairpin adapters, and serves to ratchet each molecule through the nanopore one base at a time. Enrichment for molecules containing hairpin adapters and bound motor protein was performed using His-Tag Dynabeads® (Life Technologies).
6
Purification of Hrd1 Protein
7
Plasma Antibody Binding Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
400 μL of vortexed Invitrogen His-Tag Dynabeads (ThermoFisher 10104D) were aliquoted into microcentrifuge tubes and incubated on an Invitrogen DynaMag-2 Magnet (ThermoFisher 12–321-D) for two minutes. The supernatant was discarded and beads were washed with 300 μL TBST. After a two-minute incubation on the magnet, the supernatant was discarded and 100 μg of his-tagged S, S1, S2(Pre), S2(Post), NTD, or RBD in 300 μL TBST was left to incubate with the beads for 10–20 min at room temperature. The magnet was used and supernatant discarded. The beads were spun down, put on the magnet, and excess liquid was removed before addition of 15–20 μL of plasma of interest. The plasma was left to incubate at room temperature with the beads for 20–30 min before being removed.
8
Quantifying SARS-CoV-2 Pseudovirus-ACE2 Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To ensure that equal amounts of pseudovirions were used in the study, input pseudovirions were quantified by a reverse transcription-quantitative PCR (RT-qPCR) assay. To eliminate the contamination of packaging plasmids in the assay, pseudovirion stocks were pretreated with DNase I (catalog number M0303L; New England BioLabs) at 37°C for 20 min, followed by viral RNA isolation (QIAamp viral RNA minikit, catalog number 52906). RT-qPCR quantification was conducted using the following primers and probe: forward primer GGCTGAATACAAACCATCGG , reverse primer CGCTCGTTGTAGATGTCGTTAG , and probe FAM (6-carboxyfluorescein)-CCCTGTTCATCGGTGTGGCTGT -BHQ1 (black hole quencher 1).
A total of 1010 RNA copies of pseudovirions were incubated with 1.5 μg recombinant human ACE2 protein (catalog number 933-ZN-010; R&D Systems) or mouse ACE2 protein (catalog number 3437-ZN-010; R&D Systems) and 15 μl His tag Dynabeads (catalog number 10103D; Thermo Fisher) for 3 h at room temperature. After incubation, the resulting beads were washed three times with phosphate-buffered saline (PBS), followed by RNA isolation with TRIzol reagent (catalog number 15596026; Thermo Fisher). Bound pseudoviral RNA was quantified using RT-qPCR. The binding of each pseudovirion was normalized against the level of binding (“noise”) obtained when an equal amount of bald pseudovirions was used in the assay.
A total of 1010 RNA copies of pseudovirions were incubated with 1.5 μg recombinant human ACE2 protein (catalog number 933-ZN-010; R&D Systems) or mouse ACE2 protein (catalog number 3437-ZN-010; R&D Systems) and 15 μl His tag Dynabeads (catalog number 10103D; Thermo Fisher) for 3 h at room temperature. After incubation, the resulting beads were washed three times with phosphate-buffered saline (PBS), followed by RNA isolation with TRIzol reagent (catalog number 15596026; Thermo Fisher). Bound pseudoviral RNA was quantified using RT-qPCR. The binding of each pseudovirion was normalized against the level of binding (“noise”) obtained when an equal amount of bald pseudovirions was used in the assay.
9
DELs Synthesis and BRD4-1 Interaction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DELs were prepared using a split-and-pool methodology at HitGen Ltd. (Chengdu, China) following a general strategy similar to that described in Kung et al. 52 Bromodomain 1 of BRD4 (cat. 6x-His-tev-BRD4-1(44-170)) was purchased from XTAL Biostructures (Natick, MA). The magnetic affinity beads used were either Neutravidin SpeedBeads (GE Healthcare, Piscataway, NJ) or His-Tag DynaBeads (Thermo Fisher, Carlsbad, CA).
10
Purification of His-Tagged Proteins from Transfected HEK293T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HEK293T cells were either un-transfected or transfected with plasmids for expression of HIS-tagged proteins using Lipofectamine 3000 (Thermo). After 48 hours, the cells were washed with 1XPBS and total cell extract was prepared from the cells using M-PER (Thermo) containing EDTA-free protease and phosphatase inhibitor cocktail (Thermo) according to the manufacturer's recommended protocol. Protein was quantitated using the Bradford Assay. His-tagged proteins were purified as follows: 200 μg of cell lysate was incubated with 30 μl of His-Tag Dynabeads (Invitrogen) with gentle agitation for 20 minutes at 4° C. Dynabeads were collected by magnet then washed 5 times with 500 μl Binding/Wash buffer. After final wash, buffer was aspirated and beads were incubated with 65 μl Elution buffer (300 mM imidazole, 50 mM Na-phosphate pH 8.0, 300 mM NaCl, 0.01% Tween-20) for 20 min, then beads were collected via magnet. The supernatant containing the purified HIS-tagged protein complex was transferred to a fresh tube, 15 μl of 5x SDS-PAGE sample buffer was added and the sample was denatured for 5 min at 95° C. 20 μl of sample was analyzed by SDS-PAGE and Western Blotting.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!