Propylamine

As-drawn (AD) fibre pieces were cleaved as described above, then washed in triplicate with acetone (Fisher Chemicals, 99.5%) and isopropanol (Fisher Chemicals, 99.5%). During each wash, the fibres were placed in a 10 mL scintillation vial and held in an ultrasonic cleaner for 5 min. Following this, the fibres were left in ambient conditions to allow the solvent to evaporate then wrapped in lens tissue (Ted Pella, Inc.) and stored in a silica glass vial for up to 5 days before use.
To prepare propylamine etched (PE) fibres, as-drawn cleaved fibre pieces were collectively submerged in 5 mL of propylamine (Sigma-Aldrich, 99.0%), within a scintillation vial for 0.5 h, then washed in triplicate with acetone, and isopropanol. During each wash, the fibres were placed in a 10 mL scintillation vial and held in an ultrasonic cleaner for 5 min. Following this, the fibres were left in ambient conditions to allow the solvent to evaporate, then placed into a new scintillation vial, wrapped in lens tissue, and transferred into an MBraun glove box, with a nitrogen atmosphere, with 0.6 ppm H₂O and 0.1 ppm O₂ for storage up to 5 days before use.

Cholesterol-tagged DNA (sequence: 5ʹ (Cy3)-ACCAGACAATACCACACAATTTT-CholTEG 3ʹ, HPLC purified) and the Cy-5 labeled triplex-forming DNA (sequence: 5ʹ Cy5-TTCTCTTCTCGTTTGCTCTTCTCTTGTGTGGTATTGTCTAAGAGAAGAG 3ʹ, adapted from Green et al.^{36 (link)}, HPLC purified) were purchased from Biomers or Integrated DNA Technologies. Both DNA sequences were encapsulated in microfluidic droplets at a concentration of 1.5 μM and 1 μM, respectively. For the calibration measurement (Fig. 3b), the aqueous solution inside the droplets additionally contained 50 mM potassium phosphate buffer at the respective pH. Propylamine (from Sigma Aldrich) and Trifluoracetic Acid (TFA, from Sigma Aldrich) were flushed to dynamically change the pH of the droplets’ aqueous phase. For the co-encapsulation of the DNA together with the E. coli (OD₆₀₀ ≈ 20), a two-inlet droplet formation device was used (see Supplementary Fig. 7). Droplets were sealed in an observation chamber for confocal fluorescence imaging experiments.