Knockdown of miR-145-5p in glioma cells was achieved via X2 lipid transfection (Mirus Bio, MIR-6004) of hsa-miR-145-5p miRCURY LNA miRNA Power Inhibitor (Exiqon, YI04102423-DCA) or miRCURY LNA miRNA Power Inhibitor Negative Control A (Qiagen, YI00199006-DDA) at a final concentration of 50 nM and confirmed by RT-qPCR with the miRCURY LNA Universal RT microRNA PCR system (Qiagen) and a StepOnePlus thermocycler (Applied Biosystems). Ct values for hsa-miR-145-5p (Qiagen, YP00204483) were normalized to expression levels of hsa-miR-423-5p (Qiagen, YP00205624) to determine fold change.
Mircury lna mirna power inhibitor
Manufactured by Qiagen
Sourced in United States
The MiRCURY LNA miRNA Power Inhibitors are highly specific and potent inhibitors designed for the detection and analysis of microRNA (miRNA) expression. They provide a reliable and effective way to suppress the function of target miRNAs in cellular and in vivo studies.
Automatically generated - may contain errors
Lab products found in correlation
Mircury lna mirna power inhibitor control, by Qiagen (2 mentions)
Txnip crispr activation plasmid, by Santa Cruz Biotechnology (2 mentions)
Gsk3787, by Abcam (2 mentions)
Control crispr activation plasmid, by Santa Cruz Biotechnology (2 mentions)
Gw0742, by Bio-Techne (2 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (2 mentions)
Steponeplus thermocycler, by Thermo Fisher Scientific (1 mentions)
Mircury lna universal rt microrna pcr system, by Qiagen (1 mentions)
Mircury lna mirna mimic, by Qiagen (1 mentions)
Hiperfect transfection reagent, by Qiagen (1 mentions)
Easysep mouse f4 80 positive selection kit, by STEMCELL (1 mentions)
Opti mem medium, by Thermo Fisher Scientific (1 mentions)
Lipofectamine rnaimax transfection reagent, by Thermo Fisher Scientific (1 mentions)
4d nucleofector device, by Lonza (1 mentions)
P3 primary cell 4d nucleofector kit, by Lonza (1 mentions)
Lipofectamine rnaimax reagent, by Thermo Fisher Scientific (1 mentions)
8 protocols using mircury lna mirna power inhibitor
1
Inhibition of miR-145-5p in Glioma Cells
2
Neuroprotective Interventions for Hypoxic-Ischemic Brain Injury
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
GW0742 (25 μg/kg; Tocris Bioscience) or vehicle was administered by intranasal method at 1 and 24 hours after HI. PPAR‐β/δ antagonist GSK3787 (300 μg/k; Abcam) or vehicle (1% DMSO in corn oil) was given by intranasal administration at 1 hour before HI and at 24 hours post‐HI. 0.5 nmol of LNA miR‐17‐5p inhibitor (antimiR, rno‐miR‐17‐5p miRCURY LNA miRNA Power Inhibitor; Exiqon) or control (miRCURY LNA miRNA Power Inhibitor Control; Exiqon) were injected intracerebroventricularly (ICV) during 3% isoflurane anaesthesia into the ipsilateral hemisphere at 24 hours before HI. 1 μg of TXNIP CRISPR activation plasmid (Santa Cruz Biotechnology, Dallas) or control CRISPR Activation Plasmid (Santa Cruz) were injected intracerebroventricularly to the ipsilateral hemisphere at 48 hours pre‐HI. Coordinates for ICV injection were as follows: 1.5 mm posterior, 1.5 mm lateral to the bregma and 2.5 mm deep into the ipsilateral hemisphere. Total volume of 2 μL of drug per pup was injected slowly in 5 minutes. The needle was left in place for an additional 10 minutes and then slowly withdrawn over 5 minutes to prevent backflow.
3
Neuroprotective Interventions in Neonatal Hypoxic-Ischemic Injury
4
Murine Macrophage Transfection Optimization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Transfections of macrophages isolated from mice were performed using miRCURY LNA miRNA mimics and miRCURY LNA miRNA power inhibitors (Qiagen), as described (18 (link)). For control, negative control of mimic and negative control of power inhibitor were used. Transfections were performed using HiPerfect transfection reagent (Qiagen). Briefly, liver MNCs were isolated from MAS mice as described above, and macrophages were isolated from liver MNCs using the EasySep™ Mouse F4/80 Positive Selection Kit (STEMCELL Technologies) following the protocol provided by the manufacturer. Two million macrophages were transfected with 50 nM concentration of mimic, 50 nM concentration of inhibitor, and respective control independently and incubated at 37°C and 5% CO2 for 4 days in DMEM containing heat-inactivated 10% FBS and 1% penicillin/streptomycin.
5
Anti-miRNA Inhibitors for let-7a and miR-124a
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Custom miRCURY LNA miRNA Power inhibitors and scrambled sequence inhibitors for let-7a and miR-124a were purchased from Qiagen (Calif., USA). The gene sequences for the anti-miR inhibitors for let-7a and miR-124a are AACUAUACAACCUACUACCUCA and UGGCAUUCACCGCGUGCCUUA, respectively. The scrambled gene sequences for the anti-miR inhibitors for let-7a and miR-124a are AAAUAGACCACAUAAUAACUAA and UGUCAUGCAACGAGUUCCGUA, respectively. In both cases, 1.5 × 105 RD/SHSY-5Y/NTERA-2 cells were seeded in wells of a 24-well plate and transfected with 25 pmol anti-miR inhibitor specific for let-7a and 25 pmol anti-miR inhibitor specific for miR-124a with Lipofectamine 2000 reagent (Invitrogen, Calif., USA). After 24 h incubation, viral RNA transfection was carried out. Subsequently after 4 h, the transfection medium was removed and replaced with 500 μl 10% FBS DMEM without penicillin/streptomycin (Gibco, Massachusetts, USA).
6
Intracerebroventricular Injection of miR-150-5p Inhibitor in Fetal Rats
7
Blocking miRNA with LNA Inhibitors in HUVECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Anti-miRNA ASOs were purchased from Qiagen (miRCURY LNA miRNA Power Inhibitors); these have a phosphorothioate-modified backbone and incorporate locked nucleic acids. MiRCURY LNA Power Inhibitor Negative Control A was used as a control ASO (termed scramble ASO). The use of scrambled sequence ASO is the recommended negative control for ASO miRNA blockade experiments. 20 Lipofectamine-based transfection was used; culture media on 6-well plates was changed to 2 mL Opti-MEM Medium (Gibco) supplemented with 3 µL of Lipofectamine RNAiMAX Transfection Reagent (Invitrogen) and ASO to a final concentration of 25-50 nM. For reactive oxygen species (ROS) assays (further details below), 96-well plates were required; well volume was 200 µL; and lipofectamine/ASO was diluted such that their concentration matched the 6-well plates. HUVECs were transfected for 8 hours, 1 day before hypoxia and reoxygenation as described above. A no transfection control was treated in an identical fashion but lacking both lipofectamine and ASO.
8
Modulating Cacnb2 Expression in Hippocampal Neurons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primary hippocampal neurons were transfected with plasmid DNA, miRNA mimics (Ambion™ Pre‐miR miRNA Precursor, Thermo Fisher), and pLNAs (miRCURY LNA miRNA Power Inhibitors; QIAGEN) using the Lipofectamine 2000 reagent (Thermo Fisher). To measure Cacnb2 mRNA levels upon miR‐499‐5p overexpression, hippocampal neurons were transfected at DIV7 with 10 nM of the miR‐499‐5p or control mimic (Ambion™ Pre‐miR miRNA Precursor: miR‐499‐5p and Neg Control 1, Thermo Fisher) with the Lipofectamine RNAiMAX reagent (Thermo Fisher) and processed 7 days later for total RNA extraction. To validate the overexpression efficiency of the pMT2‐CACNB2 plasmid (Addgene, #107424), freshly isolated cortical neurons were transfected using the P3 Primary Cell 4D‐Nucleofector Kit (Lonza, LZ‐V4XP‐3024) and the program DC‐104 of the 4D‐Nucleofector device (Lonza). After 5 DIV, cells were processed for Western Blot analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!