Hotstartaq plus master mix

Two conventional PCR (cPCR) assays were used to screen DNA extracted from FFPE liver for presence of DCH. Primer set 1 (Hgap-F/Hgap-R) [4 (link)] amplifies a 230 bp region of the viral genome, and primer set 2 (FeHep.2116F (GCACCTGGATTCGCACAC)/FeHep.2371R (CCTTGAGGGAGTAAAGCCCTG)) amplifies a 256 bp region (Figure 1). The 25 μL reactions contained 12.5 μL HotStarTaq Plus Master Mix (Qiagen), 0.5 μM forward primer, 0.5 μM reverse primer, 2.5 μL dye, and 100–200 ng of purified DNA. Cycling conditions were an initial activation step of 95 °C for 5 min, followed by 40 cycles of 94 °C for 30 s, 55 °C for 30 s (52 °C for primer set 2), and 72 °C for 30 s, with a final elongation step at 72 °C for 10 min. Amplicons were evaluated by 1.5% agarose gel electrophoresis. The identity of bands of the correct size was confirmed by cloning, using the TOPO TA Cloning kit (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA), Sanger sequencing (DNA sequencing facility, UC Davis).

DNA was extracted from adipose fin clips using the HotSHOT method (Truett et al. 2000 (link)). PCR amplification was carried out using a BIO-RAD MyCycler Thermal Cycler in 10 μL reaction volumes containing 1 μL of extracted DNA (c. 30 ng DNA), 3 μL RNase-free water, 5 μL of QIAGEN HotStarTaq Plus Master Mix, and 1 μL of primer mixture, in a total of 8 microsatellite multiplexes (Table S2). PCR conditions were as follows: an initial denaturing step at 95°C for 5 min was followed by 20 cycles of touchdown PCR consisting of 30 s at 94°C, a 30 s annealing step starting at 60°C or 55°C and decreasing by 0.5°C each cycle until a touchdown temperature of 50°C or 45°C (dependent on multiplex; Table S2) was achieved, and an elongation step of 72°C for 30 s, followed by 15 cycles comprising 94°C for 30 s, 50°C or 45°C for 30 s, and 72°C for 30 s. This was followed by a final 10 min extension step at 72°C. Genotyping was performed on a Beckman Coulter CEQ™ 8000 Genetic Analysis System.

Each PCR reaction was performed in a 25-μL reaction volume with 1× HotStar Taq^® Plus Master Mix (QIAGEN GmbH, Hilden, Germany), various concentrations of forward and reverse primers and 50 ng genomic DNA as the template. The tested primer concentrations were 0.16, 0.24, 0.32, 0.40 and 0.8 μM. Two primer pairs (CITS-F10′/CITS- R′-2 and COI-F/COI-R) were simultaneously added into the PCR reaction system to develop a duplex PCR assay for Chinese cordyceps identification. Primer combinations at different concentrations were tested to determine the optimal proportions that influenced the amplification efficiency. A gradient PCR was performed with annealing temperatures ranging from 50 °C to 60 °C in an ABI Veriti 96 thermal cycler (Applied Biosystems). Six temperatures in a gradient, 50 °C, 52 °C, 54 °C, 56 °C, 58 °C and 60 °C, were tested to determine the optimal annealing temperature. The program was as follows: one step of 5 min at 95 °C, 35 cycles of 30 s at 95 °C, 30 s at 50 °C–60 °C and 30 s at 72 °C; followed by one step of 7 min at 72 °C. The PCR products were size separated using electrophoresis on 2.5% agarose gel in 1 × Tris-acetate-EDTA buffer and stained with GelRed Nucleic Acid Stain (Cat. 41003, Biotium, Inc. Fremont, CA, USA) for visualisation. The amplicons were further confirmed by cloning and sequencing (Sangon Biotech (Shanghai) Co. Ltd.).

To extract the DNA, the eight samples were treated overnight with 10 mg/mL lysozyme (Roche, Basel, Switzerland) with agitation at 37°C followed by cetyltrimethylammonium bromide (CTAB) DNA extraction (28 (link)). DNA was precipitated using isopropanol overnight, and dried DNA for each sample was resuspended in 12 μL of Tris-EDTA.
Real-time PCR quantification of the extracted DNA was performed in triplicate by amplifying the single-copy rpoB gene (forward primer, 5′ ACG GTC GCT TCG TCG AG 3′; reverse primer, 5′ GGG CAC GTA CTC CAC CTC 3′) using a standard curve. Each 10-μL reaction solution comprised nuclease-free water (23.5 μL), Qiagen HotStarTaq Plus master mix (5 μL), SYTO9 (1 μL), SSO Advanced (5 μL) primer mix (0.5 μL), and DNA (1 μL). The amplification protocol consisted of an initial activation step of 95°C for 30 s, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s, with a change of 1.6°C/s increments, and a melting step of 65°C for 15 s and 95°C for 15 s with a change of 0.2°C/s increments. All reactions were performed using QuantStudio 5 (Thermo Fisher Scientific).

DNA was extracted from swabs immediately after thawing using the QiaAMP DNA Micro Kit (Qiagen, Germantown, MD, USA). DNA was extracted from frozen tissues and from 25 µm scrolls of FFPE tissue after being deparaffinized in xylene and rehydrated with 100%, 90% and 70% ethanol, using a commercial kit (DNeasy^® Blood & Tissue Kit, QIAGEN, Hilden, Germany). DNA samples testing negative for feline glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using conventional PCR (cPCR) were excluded [20 (link)]. A cPCR amplifying a 164 bp fragment of the FcaGHV1 glycoprotein B (gB) gene was performed as described previously [21 (link)].
The 25-µL reactions contained HotStarTaq Plus Master Mix (Qiagen), 2.5 µL of extracted DNA, 0.2 µM concentrations for each primer GH-3F 5′-TGACATGTAACGCAGTCTATG-3′ and GH-3R 5′-TCTGTGCATGATTCGTTCCAT-3′. The mixtures were amplified with an initial denaturation at 95 °C for 5 min followed by 40 cycles at 94 °C for 30 s, 50 °C for 30 s, and 72 °C for 30 s. There was a final extension at 72 °C for 10 min.

DNA was extracted using QIAamp DNA Mini kits or DNA FFPE Tissue kits (Qiagen Ltd, Manchester, UK). Reactions were performed in a total volume of 25 μl, and contained 100 ng DNA (where possible), each primer at 250 nM (IDT, Leuven, Belgium) and 1 x HotStarTaq Plus Master Mix (Qiagen). Thermal cycling was carried out on a GeneAmp PCR System 9700 (Applied Biosystems, Life Technologies). Initially, all primer sets used identical thermal cycling conditions: 95 °C for 5 min, followed by 40 cycles of 95 °C for 30 s, 58 °C for 30 s, 72 °C for 30 s, with a final extension of 72 °C for 30 min to facilitate addition of terminal adenosine bases on each PCR product. Following optimisation, the annealing temperature for primer sets 9, 10, 13 and 14 only was reduced to 50 °C consistent with the low melting temperatures of primers 929 and 931.
Fragment analysis was carried out using GeneScan methodology on an ABI 3130×l Genetic Analyser (Applied Biosystems) with a 36 cm capillary length loaded with POP-4 polymer. Products amplified with primer sets 1 and 4, 2 and 5, and 3 and 6, were combined prior to fragment analysis; 5′ primers in each combination were labelled with different fluorochromes so that reaction products could be distinguished (Table 3).