At the end of the recording, the cytosolic content was aspirated into the patch pipette, and expelled into a 200 μL PCR tube (Axygen, USA) as described previously56 (link). The single-cell RT-PCR protocol was designed to detect the presence of mRNAs coding for Vgat. Reverse transcription and the first round of PCR amplification were performed with gene-specific multiplex primer using the SuperScript III One-Step RT-PCR kit (12574018, ThermoFisher, USA). The first reaction was performed as follows: 30 min at 55 °C, 2 min at 94 °C; 35 cycles of 15 s at 94 °C, 30 s at 55 °C, and 50 s at 68 °C; and 5 min at 68 °C. A second PCR was then conducted with nested primers. The first PCR product (1–2 μL) was used as template for a second PCR. In this second round, the reaction was performed as follows: 2 min at 94 °C; 35 cycles of 15 s at 94 °C, 30 s at 55 °C, and 30 s at 68 °C; and 5 min at 68 °C. The final PCR products were visualized by electrophoresis in agarose gels (2.0%) with SafeGel. The expected size of each final PCR product is VGAT 250 bp. The specific primers for Vgat gene were custom designed and synthesized (Sangon, Shanghai) based on a previous reference57 (link). Sense, 5′ATTCAGGGCATGTTCGTGCT3′; antisense, 5′ ATGTGTGTCCAGTTCATCAT3′; nested, 5′TGATCTGGGCCACATTGACC3′.
Superscript 3 one step rt pcr kit
Manufactured by Thermo Fisher Scientific
Sourced in United States, Germany, United Kingdom
The SuperScript III One-Step RT-PCR kit is a reagent system designed for one-step reverse transcription and PCR amplification of RNA templates. It combines a reverse transcriptase enzyme and a DNA polymerase in a single reaction mix to facilitate the conversion of RNA to cDNA and subsequent amplification.
Automatically generated - may contain errors
Lab products found in correlation
Trizol, by Thermo Fisher Scientific (9 mentions)
Qiaamp viral rna mini kit, by Qiagen (8 mentions)
Purelink rna mini kit, by Thermo Fisher Scientific (6 mentions)
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Redsafe, by iNtRON Biotechnology (3 mentions)
Qiaquick gel extraction kit, by Qiagen (3 mentions)
Platinum taq dna polymerase, by Thermo Fisher Scientific (3 mentions)
Abi steponeplus system, by Thermo Fisher Scientific (3 mentions)
Qiaquick pcr purification kit, by Qiagen (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Magmax 96 total rna isolation kit, by Thermo Fisher Scientific (3 mentions)
Platinum taq polymerase, by Thermo Fisher Scientific (3 mentions)
Lc480 real time cycler, by Roche (2 mentions)
Dnase 1, by Roche (2 mentions)
Qiazol, by Qiagen (2 mentions)
Amplitaq gold, by Thermo Fisher Scientific (2 mentions)
Gene flash, by Syngene (2 mentions)
Lightcycler 480 real time pcr system, by Roche (2 mentions)
Fusion fx system, by Vilber (2 mentions)
3130 genetic analyzer, by Thermo Fisher Scientific (2 mentions)
101 protocols using superscript 3 one step rt pcr kit
1
Single-Cell RT-PCR for VGAT Gene Detection
2
Genetic Landscape of fkb-6 Mutations
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the genetic landscape of fkb-6(tm2614), we performed RT-PCR analysis. This was done using the Superscript III OneStep RT PCR kit (12574-026; Thermo Fisher Scientific) and primers 5′-CTTGAAGCGCTTCTTGTCACGC-3′ and 5′-CCAACCACTGGAACGACCGTG-3′. Our analysis revealed a deletion of the last 119 amino acids of the 431-aa protein. There was also a simultaneous insertion of 52 amino acids. This deletion removes the third TPR domain and part of the second TPR domain. Our analysis also showed that transcript levels are not different from a wild-type background. RT-PCR of other fkb-6 mutations, created through CRISPR-Cas9, was performed. Using the technique described earlier, we found that fkb-6(iow4) is a 230-bp deletion that contains a 166-bp deletion of the promoter and 64-bp of the first exon; this deleted region encodes for the first 79 amino acids of the FKB-6 protein, which includes the first PP domain. Another small deletion mutation leading to sterility, fkb-6(iow3), was isolated and had a frameshift around the PAM site of the sgRNA (5′-GTTGAAACTCATCAAGAAGGAGG-3′). Both of these mutants were examined by DAPI and SYP-1 staining and were shown to exhibit a phenotype indistinguishable from that of the fkb-6(tm2614) allele.
3
RNA Extraction and qRT-PCR Analysis of Metal-Stressed Bacteria
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNA extraction and qRT-PCR analysis, untreated or metal-stressed bacteria (LB supplemented with 400 μM ZnSO4, 400 μM CuSO4, or 400 μM ZnSO4 + 400 μM CuSO4) were harvested at mid log-phase and lysed in QiaZol (Qiagen) as described previously [55 (link), 56 (link)]. Following the addition of chloroform and phase separation, RNA was extracted and purified using a PureLink RNA Mini Kit (Thermo Fisher Scientific), according to the manufacturer’s instructions. The total RNA samples were treated with DNase I (Roche) and qRT-PCR performed using the SuperScript III One-Step RT-PCR kit (Thermo Fisher Scientific) on a LC480 Real-Time Cycler (Roche). Transcription levels of genes were corrected to those obtained for GAPDH prior to normalization to the transcription levels observed for untreated A. baumannii cultures. Primer sequences are listed in Additional file 2 . Results are the mean (± SEM) of at least three independent experiments, with the statistical significance determined using a one-way ANOVA with Dunnett’s post-test.
4
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Prior to extraction of RNA using a RNeasy spin column (Qiagen), blood from the posterior vena cava was treated with red blood cell lysis buffer and lung tissues were treated with RNAlater solution (Ambion). All samples were DNase I treated (Qiagen) on the column during purification. For examination of SA100A8 transcripts, qRT-PCR analyses were performed using a SuperScript III One-Step RT-PCR kit (Thermo Fisher Scientific) on a QuantStudio 7 Real-Time Cycler (Thermo Fisher Scientific). Transcription levels of genes analysed were normalized to those obtained for ACTB. Data represent the mean (± S.E.M.) of two independent experiments with treatment cohorts comprised of at least six mice. The examination of mouse immune markers by qPCR was conducted using the TaqMan Array Mouse Immune Panel (Thermo Fisher Scientific) on a QuantStudio 7 Real-Time Cycler (Thermo Fisher). The TaqMan Arrays analyses were performed in triplicate, with each sample representing RNA pools from at least three mice. The results were analysed using the ThermoFisher Cloud Software. For the TaqMan Arrays analyses, data represent the mean (± S.E.M.), with statistical analyses performed using a one-way ANOVA.
5
Retrotransposed ARTenvV ORF Amplification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT—PCR for total RNA samples was performed using the Superscript III one step RT-PCR kit (Thermo Fisher) with the following program: 55°C for 30min; 95°C for 3min; 35 cycles of 95°C for 30s, 58°C for 30s, and 72°C for 120s; and 72°C for 5min. 5’ and 3’ RACE-PCR on total RNA isolated from cell lines was performed using SMARTer RACE 5’/3’ kit (Clontech) following manufacturer’s instructions. Primers used in this study are provided in S3 Table .
PCRs for amplifying the region surrounding the retrotransposed copy of ARTenvV ORF in genomic DNA samples were performed using Amplitaq Gold (Thermo Fisher) with the following program: 95°C for 3 min; 35 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 90s; and 72°C for 5min using the relevant primers (S3 Table ).
RT—PCR and PCR products were analyzed by 1% agarose gel electrophoresis and cloned into the PCR 2.1 TOPO plasmid (Thermo Fisher), following manufacturer’s instructions before sequencing. Gel images were captured using GENE FLASH (Syngene, Frederick, MD).
PCRs for amplifying the region surrounding the retrotransposed copy of ARTenvV ORF in genomic DNA samples were performed using Amplitaq Gold (Thermo Fisher) with the following program: 95°C for 3 min; 35 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 90s; and 72°C for 5min using the relevant primers (
RT—PCR and PCR products were analyzed by 1% agarose gel electrophoresis and cloned into the PCR 2.1 TOPO plasmid (Thermo Fisher), following manufacturer’s instructions before sequencing. Gel images were captured using GENE FLASH (Syngene, Frederick, MD).
6
Virus Detection via RT-PCR Verification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The identity of virus-like sequences detected by HTS was verified by RT-PCR using primers designed from the viral contigs and targeting RdRP and CP or NC genes of the viral genomes (Table S4 ). RT-PCR was done with total RNA extracted from 100 mg of individual leaf samples using a RNeasy Plant Mini Kit (Qiagen), 10 μM of each primer and Superscript III One-Step RT-PCR kit with Platinum®Taq DNA polymerase (Thermo Fisher Scientific) following the manufacturer’s protocol. RT-PCR conditions were 50 °C for 30 min, 94 °C for 2 min, 35 cycles of 94 °C for 15 s, 55 °C for 30 s, and 68 °C for 1 min, followed by a final extension at 68 °C for 5 min. Amplicons were analyzed on 1% agarose/TBE gel, DNA bands stained using Redsafe™ (iNtRON Biotechnology, South Korea) and visualized under UV light using a gel documentation system (BioRad, Gladesville, NSW, Australia). DNA bands were excised, gel-purified using Wizard® DNA clean up system (Promega), and quantified by Nanodrop® spectrophotometer. Amplicons were either sequenced directly or first ligated into pGEM-T Easy (Promega) and sequenced at the AGRF using M13 forward and reverse primers.
7
Evaluation of Finecare™ SARS-CoV-2 Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sensitivity of FinecareTM was determined using sera from 150 RT-PCR–confirmed individuals (7–>21 days). Qiagen extraction kit was used to extract RNA from nasopharyngeal swab specimens. Then, the SuperscriptIII One-Step RT-PCR kit was used to test for SARS-CoV-2 according to manufacturer's instruction (Cat No. 12594100, ThermoFisher, USA) (Yassine et al., 2021 (link)). Samples were tested using 2 sets of primers targeting the E gene and confirmed with 2 different sets of primers targeting the RdRp gene (Corman et al., 2020 , Yassine et al., 2021 (link)). Complete descriptions for these participants are summarized in Table S1. The specificity was examined using 100 prepandemic plasma samples collected before 2019, which were used in previous studies (Nasrallah et al., 2018 (link), Nasrallah et al., 2019 (link), Smatti et al., 2020 (link)). The panel included plasma samples seropositive for (a) dengue virus (n = 26), (b) parvovirus B19 (n = 8), and (c) nonrespiratory viruses (n = 66).
8
PCR and RT-PCR Protocols for Peromyscus TrimCyp
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCRs for genomic DNA samples were performed using Amplitaq Gold (Thermo Fisher) with the following program: 95 °C for 3 min; 35 cycles of 95 °C for 30 s, 54 °C for 30 s, and 72 °C for 150 s; and 72 °C for 5 min. Primers used to screen for the presence of CypA downstream of a Trim30d gene in the genomic DNA of the Peromyscus species are shown in Supplementary Table S2 . The primers designated 4 F and 4 R were used for sequencing the retrotransposed CypA that is part of the TrimCyp gene in the genomic DNA of the various Peromyscus species (Supplementary Table S2 ).
Reverse transcription (RT)–PCR for total RNA samples was performed using Superscript III one step RT-PCR kit (Thermo Fisher) with the following program: 55 °C for 30 min; 95 °C for 3 min; 35 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 150 s; and 72 °C for 5 min. The primers designated 5 F and 5 R were used to amplify TrimCyp cDNA from the Peromyscus species (Supplementary TableS2 ). PCR and RT-PCR products were analyzed by 1% agarose gel electrophoresis and cloned into the PCR 2.1 TOPO (Thermo Fisher) plasmid before sequencing. Gel images were acquired using GENE FLASH (Syngene, Frederick, MD).
Reverse transcription (RT)–PCR for total RNA samples was performed using Superscript III one step RT-PCR kit (Thermo Fisher) with the following program: 55 °C for 30 min; 95 °C for 3 min; 35 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 150 s; and 72 °C for 5 min. The primers designated 5 F and 5 R were used to amplify TrimCyp cDNA from the Peromyscus species (Supplementary Table
9
RT-PCR Analysis of cul-4(ok1891) Strain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT-PCR was performed in cul-4(ok1891) strains. Superscript III OneStep RT-PCR kit (12574–026; Thermo Fisher Scientific) and primers 5’-ttagctgctttcgagccttc-3’ and 5’-gcttcaaatccgcaaatgat-3’. The obtained RT-PCR fragment was sequenced to reveal a deletion of part of exon 10 and most of exon 11 which created an out of frame deletion (junction sequence: TCTCGATCAAATGGTA/AGAAGGAAGGTACTGTG).
10
Quantifying SARS-CoV-2 Variant Ratios via RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ratios of R203/G204: 203K/204R RNA were determined via RT-PCR with quantification of Sanger peak heights. Briefly, R203/G204 and 203K/204R viruses were mixed at PFU ratios of 1:1, 3:1 and 9:1 based on their PFU titers. To quantify R203/G204: 203K/204R ratios, a 596 bp RT-PCR product (Primers: SARS-CoV-2 28354F, 5¢-CCAGAATGGAGAACGCAGTG-3¢; SARS-CoV-2 28949R, 5¢-TGTCAAGCAGCAGCAAAGC-3¢) was amplified from the extracted RNA using a SuperScript III One-Step RT–PCR kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. The PCR product was purified by a GeneJET PCR Purification kit (Thermo Fisher Scientific) and submitted to Sanger sequencing (BGI, Shanghai, China) (Primer for Sanger sequencing: 5¢-CCAGAATGGAGAACGCAGTG-3¢). The sequence electropherograms were further scored by QSV analyzer to quantify the proportion of R203/G204 and 203K/204R viruses. The correlation between input PFU ratios and output RT–PCR amplicon ratios and verification of the actual ratios of R203/G204: 203K/204R achieved upon viral mixing are shown in Figures S6 A and S6B.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!