Pyromark q24 pyrosequencer

DNA methylation assay was performed according to the previously described protocols^{47 (link)}. Briefly, DNA from individual mouse ovaries and granulosa cells was extracted and bisulfite converted using the EZ DNA Methylation Gold Kit (Zymo Research, Orange, CA USA) according to the manufacturer’s instructions and was eluted in 20 μL of water. Pyrosequencing primers were designed for each target of interest using PyroMark Assay Design 2.0 software (Qiagen Inc., CA, USA) to amplify the bisulfite-modified target region. PCR reactions were carried out with 25 ng of bisulfite-converted DNA using the PyroMark PCR kit (Qiagen Inc., CA) in a final volume of 25 µL containing 12.5 µL 1 × PyroMark PCR Master Mix, 2.5 µL 1 × CoralLoad Concentrate, 0.5 µL of each primer in a final concentration of 0.05 µM, and 8 µL of water. Amplification conditions were as follows: 95 °C for 15 min, 45 cycles of 94 °C for 30 s, 56 °C for 30 s, and 72 °C for 30 s, and finally, 72 °C for 10 min. The pyrosequencing was performed using a Pyromark Q24 pyrosequencer (Qiagen Inc., CA) following the manufacturer's recommended protocols. Pyromark Q24 software was used to calculate the percent methylation for each CpG site. The results are displayed as a pyrogram with the methylation percentage.

Genomic DNA from blood granulocytes separated from PBMC by density gradient centrifugation using Ficoll-Paque (GE Healthcare, Solingen, Germany) was extracted using the Blood DNA extraction kit according to the manufacturer’s protocol (Qiagen, Hilden, Germany). DNA bisulfite treatment was performed using the Epitect kit (Qiagen) according to manufacturer’s instruction. Samples were immediately stored at −20 °C and thereafter simultaneously analysed by pyrosequencing. Methylation assays were designed using the PyroMark Assay Design Software 2.0 (www.qiagen.com). Primer sequences for pyrosequencing are GTGGGGATTGTTTATTTTTGAGAGG (forward), biotin-AACCCTACCAAAACCACTC (reverse) and GGTTTTGGTTTTGTTTTGTA (sequencing). Methylation levels for the CpG site were assessed using Pyromark Q24 pyrosequencer (Qiagen).

To assess whether the DNA genotype of candidate editing events was homozygous or not, we performed Sanger sequencing on the liver genomic DNA from the eight animals. We then assessed the mRNA genotype at these candidate sites on a PyroMark Q24 pyro-sequencer (Qiagen, Valencia, CA). Primers were designed with PyroMark Assay Design software (Supporting Information, Table S2). PCR products were prepared using the PyroMark PCR Kit (Qiagen, Valencia, CA) following the manufacturer’s instructions. Data were analyzed with PyroMark Q24 v1.0.10 using default parameters.

The KRAS Pyro Kit 24, V1 (QIAGEN, Hilden, Germany) (cover mutations in KRAS codons 12, 13, and 61 of the human KRAS gene) and the RAS Extension Pyro Kit 24, V1 (QIAGEN, Hilden, Germany) (cover mutations in KRAS codons 59, 61, 117 and 146 of the human KRAS gene) have been conducted for the validation detection of mutations of the KRAS gene in genomic DNA of rectal cancer specimen. The PyroMark Q24 MDx platform has been used to run the Therascreen1-assay with the Software Q24, Version 2.0.7 with following PlugIns, KRAS PlugIn v1.2.0 and RAS Extention PlugIn v.1.2.1.2. We amplified regions of interest in the extracted DNA using primers in the KRAS Pyro assay (QIAGEN, Hilden, Germany). We subsequently immobilized, washed, and denatured the amplified products using the vacuum workstation and subjected those products to pyrosequencing using the PyroMark Q24 Pyrosequencer (QIAGEN, Hilden, Germany) to detect and quantify the KRAS mutations. Initial DNA input for each specimen was 100 ng.

Pyrosequencing of extracted DNA to detect IDH1 and IDH2 exon 4 mutations was performed on the Qiagen PyroMark Q24 Pyrosequencer (Qiagen, Germantown, MD).

For DNA methylation analysis of the target regions, genomic DNA was extracted with chloroform-isopropanol and bisulfite converted using the EZ DNA Methylation-Kit (Zymo Research), following the manufacturer’s protocol. Bisulfite-converted DNA (10–20 ng) was amplified by PCR in a 25 μl reaction using the Pyromark PCR kit (Qiagen). Pyrosequencing was performed on the Pyromark Q24 pyrosequencer (Qiagen) according to the manufacturer’s guidelines, using a specific sequencing primer. Analysis of methylation levels at each CpG site was determined using Pyromark Q24 Software (Qiagen). The pyrosequencing primers’ information is presented in Additional file 1: Table S1.