4T1 and YAC-1 cells were purchased from the ATCC. E0771 cells were purchased from CH3 Biosystems. AT3 cell line was a generous gift from S.I. Abrams at Roswell Park Comprehensive Cancer Center. To generate AT3-Luc, E0771-Luc or 4T1-Luc cells, the tumor cells were infected with luciferase-expressing lentivirus (Addgene) (Campeau et al., 2009 (link)). For OVA labeling, the AT3-Luc cells were transfected with pcDNA3-OVA (Addgene) (Diebold et al., 2001 (link)) to generate AT3-OVA-Luc tumor cells. For mCherry labeling, AT3 cells were infected with mCherry-expressing lentivirus (Addgene) to generate AT3-mCherry cells. To overexpress G-CSF, AT3 cells were infected with g-csf (Csf3)-expressing lentivirus (the vector was a gift from R.A. Weinberg, Massachusetts Institute of Technology) to generate AT3-gcsf cells. To generate 4T1-GFP, AT3-GFP, AT3-gcsf-GFP and E0771-GFP cells, the tumor cells were infected with green fluorescent protein (GFP)-expressing lentivirus (Addgene). Human lung fibroblast-like cells (mesenchymal stem cells) were purchased from ScienCell Research Laboratories. All cell lines were maintained in a humidified 5% CO2 incubator at 37 °C and confirmed to be mycoplasma free.
Yac 1 cells
Manufactured by American Type Culture Collection
Sourced in United States
YAC-1 cells are a type of cell line derived from Mus musculus (mouse) lymphoma. They are commonly used in natural killer (NK) cell cytotoxicity assays to evaluate the killing activity of NK cells.
Automatically generated - may contain errors
Lab products found in correlation
Penicillin, by Thermo Fisher Scientific (2 mentions)
Raw 264.7 cells, by American Type Culture Collection (2 mentions)
Atcc tib 160tm, by American Type Culture Collection (2 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (2 mentions)
Dimethyl sulfoxide (dmso), by Merck Group (2 mentions)
E0771, by Addgene (1 mentions)
Mcherry expressing lentivirus, by Addgene (1 mentions)
Pcdna3 ova, by Addgene (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Hepes buffer, by Thermo Fisher Scientific (1 mentions)
Jnk1 2, by Santa Cruz Biotechnology (1 mentions)
Elisa kits for tnf α, by R&D Systems (1 mentions)
P jnk1 2, by Santa Cruz Biotechnology (1 mentions)
Ldh release detection kit, by Roche (1 mentions)
Hrp linked anti rabbit igg secondary antibody, by Santa Cruz Biotechnology (1 mentions)
Concanavalin a (cona), by Merck Group (1 mentions)
P erk1 2, by Santa Cruz Biotechnology (1 mentions)
P nf κb p65, by Santa Cruz Biotechnology (1 mentions)
Enzyme linked immunosorbent assay, by R&D Systems (1 mentions)
Lipopolysaccharides (lps), by Merck Group (1 mentions)
12 protocols using yac 1 cells
1
Generation and Characterization of Tumor Cell Lines
2
Transfection of Cell Lines with miR-181a-5p Antagomir
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As standard tissue culture medium, we used complete RPMI or DMEM which consisted of the indicated tissue culture medium supplemented with 10% FCS, 100 IU/ml penicillin, 100 μg/ml streptomycin, 10 mM HEPES buffer (all from Gibco), and 0.05 mM 2‐ME (Amresco). Human embryonic kidney HEK293 T cells (ATCC, CRL‐3216), YAC‐1 cells (ATCC, TIB‐160), and K562 cells (ATCC, CCL‐243) were propagated in standard tissue culture medium. Human NK cell line NKL was a gift from Dr. Kerry S Campbell (Fox Chase Cancer Center, Philadelphia, PA). NKL cells were propagated in 1640 supplemented with 15% (v/v) fetal bovine serum (FBS) (Gibco), antibiotics (100 IU/ml penicillin and 25 mg/ml streptomycin), and recombinant human IL‐2 (200 U/ml). Splenocytes from mice were cultured in standard tissue culture medium with recombinant mouse IL‐2 (200 U/ml). All cells were grown at 37°C and 5% CO2.
FAM‐labeled miR‐181a‐5p antagomir or negative control antagomir (NC antagomir: cel‐miR‐67‐3p) were synthetized by Ribobio with the following sequences: mmu‐miR‐181a‐5p antagomir (sense, 5′‐ACUCACCGACAGCGUUGAAUGUU‐3′), NC antagomir (sense, 5′‐ UCACAACCUCCUAGAAAGAGUAGA‐3′). The 293 T cells, NKL cells, and splenocytes from mice were transfected with 200 nM miR‐181a‐5p antagomir or NC antagomir for 48 h in six‐well plates according to the manufacturer's protocols.
FAM‐labeled miR‐181a‐5p antagomir or negative control antagomir (NC antagomir: cel‐miR‐67‐3p) were synthetized by Ribobio with the following sequences: mmu‐miR‐181a‐5p antagomir (sense, 5′‐ACUCACCGACAGCGUUGAAUGUU‐3′), NC antagomir (sense, 5′‐ UCACAACCUCCUAGAAAGAGUAGA‐3′). The 293 T cells, NKL cells, and splenocytes from mice were transfected with 200 nM miR‐181a‐5p antagomir or NC antagomir for 48 h in six‐well plates according to the manufacturer's protocols.
3
Mouse Immune Cell Signaling Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Roswell Park Memorial Institute (RPMI) 1640 medium, Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), streptomycin, and penicillin were obtained from Life Technologies (Carlsbad, CA, USA). Enzyme-linked immunosorbent assay (ELISA) kits for TNF-α, IFN-γ, and IL-2 were from R&D Systems (Minneapolis, MN, USA). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was obtained from USB Corp. (Cleveland, OH, USA), and the LDH release detection kit was obtained from Roche Applied Science (Indianapolis, IN, USA). All kits were used according to the manufacturers’ protocols. CTX monohydrate, LPS, concanavalin A (ConA), and dimethylsulfoxide (DMSO) were obtained from Sigma-Aldrich (St. Louis, MO, USA). YAC-1 cells, a mouse lymphoma cell line, and RAW264.7 cells, a mouse macrophage cell line, were obtained from ATCC (Manassas, VA, USA; nos. ATCC®TIB-160TM and ATCC®TIB-71 TM). Antibodies against β-actin, iNOS, p-NF-κB p65, NF-κB p65, p-IκB, IκB, p-Akt, Akt, p-ERK1/2, ERK1/2, p-JNK1/2, JNK1/2, p-p38, and p38, and HRP-linked anti-rabbit IgG secondary antibody were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). All chemicals were of the highest grade commercially available.
4
Cytotoxicity Assay of NK Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
As previously described [48 (link)], NK cells were incubated with Yac-1 cells (ATCC, Manassas, VA, USA), a mouse lymphoma cell line, for 24 h. Cytotoxicity was determined by the lactate dehydrogenase (LDH) assay [49 (link)] (Roche, Basel, Switzerland) according to the manufacturer’s instructions.
5
Cytolytic Activity Assay for Isolated NK Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cytolytic activity of isolated NK cells was assessed using the Cytotox 96 ® Non‐Radioactive Cytotoxic Assay Kit (Promega, San Luis Obispo, CA) according to the manufacturer's instructions. YAC1 cells (ATCC® Manassas, VA,) served as the target cells. The assay was performed using an effector to target ratio of 50:1 with a 5‐h incubation time (Lv et al. 2012 ). Cytotoxicity percentage was calculated using the following formula: (Experimental‐Effector Spontaneous‐Target Spontaneous)/(Target Maximum‐Target Spontaneous) × 100. The results are expressed as fold change in cytolytic activity.
6
Eμ-Myc Mouse Cell Lines and RAE1 Expression
7
Cytokine and Cell Viability Assays
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Roswell Park Memorial Institute (RPMI) 1640 medium, Dulbecco’s Modified Eagle’s Medium (DMEM), fetal bovine serum (FBS), streptomycin and penicillin were purchased from Life Technologies (Carlsbad, CA, USA). Enzyme-Linked immunosorbent assay (ELISA) kits for IL-1β, IL-2, IL-4, IL-10, IL-12p70, TNF-α and IFN-γ were from R&D Systems (Minneapolis, MN, USA). 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was from USB Corp. (Cleveland, OH, USA) and the lactate dehydrogenase (LDH) release detection kit was from Roche Applied Science (Indianapolis, IN, USA). All kits were used according to the manufacturer’s protocols. CTX monohydrate, lipopolysaccharide (LPS), concanavalin (Con)A and dimethyl sulfoxide (DMSO) were from Sigma-Aldrich (St. Louis, MO, USA). YAC-1 cells, a mouse lymphoma cell line, and RAW264.7 cells, a mouse macrophage cell line, were obtained from ATCC (Manassas, VA, USA; no. ATCC®TIB-160TM and ATCC®TIB-71TM). Antibodies for β-actin, iNOS, NF-κB-p65 and secondary antibody (HRP-linked anti-rabbit IgG) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). piNOS-Luc and pNF-κB-Luc were purchased from Addgene (Watertown, MA, USA).
8
Natural Killer Cell Cytotoxicity Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
YAC-1 cells obtained from the American Type Culture Collection (ATCC, Manassas, USA) were used as target cells for NK cell activity assay, and splenocytes were isolated from control or ZPCO-treated groups for use as effector cells. Splenocytes were cocultured with YAC-1 cells in 96-well plates at a ratio of effector cells to target cells (10:1, 20:1, and 50:1) and cultured in a 5% CO2 incubator at 37°C for 24 h. YAC-1 viability rate was assessed using a WST-1 Assay Kit and a Sunrise™ enzyme-linked immunosorbent assay (ELISA) plate reader (Tecan, Männedorf, Switzerland). The NK cell activity was calculated as the survival rate of YAC-1 compared to that of the control group.
9
Splenic NK Cell Cytotoxicity Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Splenic natural killer (NK) cell activity was evaluated by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay as previously described [40 (link), 41 (link)] with few modifications. Briefly, splenic cells (effector cells), prepared as described above, and YAC-1 cells (target cells; American Type Culture Collection, Manassas, VA) were incubated together in 96-well flat-bottom plates (NuncR) (effector: target ratio of 100:1) with a total volume of 200 μl in each well. The plates were incubated at 37°C in a humidified 5% CO2 atmosphere. After 20 hours, 100 μl of the culture supernatants were removed and 40 μl of MTT (5 mg/ml; Sigma, St. Louis, MO) was added. After an additional 3 hours of incubation, the plates were subjected to an MTT assay [42 (link)]. Control wells contained either effector or target cells alone, and all tests were performed in triplicate. The optical density (OD) at 540 nm was determined by using a microplate spectrophotometer (Labsystem iEM Reader MF). The percentage of NK cell cytotoxic activity was calculated according to the formula: {1- [(OD test – OD effector cell control) / OD target cell control]} × 100.
10
Cell Culture Protocols for NK, Carcinoma, and Lymphoma Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NK-92mi cells (a human IL-2 independent NK cell line) HEC-1A cells (a human endometrial carcinoma cell line), K562 cells (a human lymphoblast cell line), CT-56 cells (a mouse colon carcinoma cell line) and YAC-1 cells (a mouse lymphoma cell line) were obtained from the American Type Culture Collection (Manassas, VA, USA). NK-92mi cells were cultured in α-MEM media supplemented with 100 U/mL penicillin, 100 U/mL streptomycin, 20% FBS (Hyclone, Logan, UT, USA), 1% vitamin solution X100 (Gibco, Waltham, MA, USA) and 2-mercaptoethanol (Gibco). HEC-1A, K562, CT-26 and YAC-1 cells were cultured at 37 °C in DMEM/F12 media supplemented with 100 U/mL penicillin, 100 U/mL streptomycin and 10% FBS in a humidified incubator in the presence of 5% CO2. All other chemicals were purchased from Sigma-Aldrich (St. Louis, MO, USA) unless otherwise specified.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!