tssRNA levels were quantified using the method developed by Henriques et al33 (link). Briefly, total RNA was extracted and large (>200 nt) and short (<200 nt) RNAs were isolated separately using miRNeasy Mini and MinElute kits (QIAGEN). Oligo-adenylation and cDNA synthesis of short RNA was performed with Superscript III and an oligo-dT primer that had an additional 5′ adaptor sequence. qPCR analysis of the short RNA was performed with forward primers specific to the 5′UTR of the gene of interest and a universal reverse primer that matched the 5′ adaptor sequence. 5s rRNA was used as a normalization standard. Statistical significance was determined with a two-tailed Student’s paired t-test
Mirneasy mini
Manufactured by Qiagen
Sourced in Germany, United States
The MiRNeasy Mini is a laboratory equipment product designed for the isolation and purification of microRNA (miRNA) from various sample types, including cells, tissues, and body fluids. It provides a reliable and efficient method for extracting miRNA for further downstream analysis and applications.
Automatically generated - may contain errors
Lab products found in correlation
Agilent 2100 bioanalyzer, by Agilent Technologies (3 mentions)
2100 bioanalyzer, by Agilent Technologies (3 mentions)
Qiazol lysis reagent, by Qiagen (2 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (2 mentions)
Miscript sybr green pcr kit, by Qiagen (2 mentions)
Rneasy mini, by Qiagen (2 mentions)
Rneasy minelute cleanup, by Qiagen (2 mentions)
Qiazol, by Qiagen (2 mentions)
Taqman small rna assay, by Thermo Fisher Scientific (2 mentions)
Rnase free dnase set, by Qiagen (2 mentions)
Mirneasy micro kit, by Qiagen (2 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Mirvana mirna isolation kit, by Thermo Fisher Scientific (2 mentions)
Novaseq 6000, by Illumina (1 mentions)
Taqman reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Minelute cleanup kit, by Qiagen (1 mentions)
E coli poly a polymerase, by New England Biolabs (1 mentions)
Dithiothreitol (dtt), by Merck Group (1 mentions)
Glycogen, by Thermo Fisher Scientific (1 mentions)
Nanodrop 2000c spectrophotometer, by Thermo Fisher Scientific (1 mentions)
35 protocols using mirneasy mini
1
Quantification of tssRNA Levels
2
Bulk DLPFC Transcriptome Profiling Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Full details on gene-level expression data from bulk DLPFC tissue have been published.31 (link) Approximately 100 mg of DLPFC tissue were dissected from autopsied brains. Samples were processed in batches of 12–24 samples for RNA extraction using the Qiagen MiRNeasy Mini (cat no. 217004) protocol, including the optional DNAse digestion step. RNA Samples were submitted to the Broad Institute’s Genomics Platform for transcriptome library construction following sequencing in three batches using the Illumina HiSeq (batch #1: 50 M 101 bp paired end reads) and NovaSeq6000 (batch #2: 30 M 100 bp paired end; batch#3: 40–50 M 150 bp paired end 121 reads).32 (link) A cut-off point of 5 for RNA Integrity Number score was used for constructing the cDNA library.33 (link) The average sequencing depth was 50 million paired reads per sample. To achieve higher quality of alignment results, a paralleled and automatic RNAseq pipeline was implemented based on several Picard metrics (http://broadinstitute.github.io/picard/ ). Eighteen thousand six hundred twenty-nine features—full-length gene transcripts—from 1092 samples remained after data preprocessing and quality control (QC).
3
Detecting microRNAs in HEK293T cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To detect miRNAs in HEK293T cells, a miRNA-enriched fraction was purified using the miRNeasy Mini and MinElute Cleanup Kits (Qiagen) according to the manufacturer’s instructions. MiRNAs were subjected to poly(T) adaptor reverse transcription as described (Shi et al., 2012) using E. coli poly(A) polymerase (New England Biolabs) and the TaqMan reverse transcription kit (Applied Biosystems) in a combined reaction. MiRNA sequences were amplified by PCR using miRNA-specific forward primers and the described universal poly(T) adaptor reverse primer. Primers used: hsa-miR-19b-3p-fwd: TGTGCAAATCCATGCAAAACTGA , hsa-miR-216a-5p-fwd: TAATCTCAGCTGGCAACTGTGA , hsa-miR-340-5p-fwd: GCTTATAAAGCAATGAGACTGATT , hsa-miR-374a-5p-fwd: CGTTATAATACAACCTGATAAGTG , hsa-miR-542-3p-fwd: GCTGTGACAGATTGATAACTGAAA .
4
Optimized RNA Extraction from Extracellular Vesicles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For RNA including miRNA purifications, SF-EVs (n = 70) and SF-Native (n = 70) samples were mixed with 600 µl QIAzol Lysis Reagent (Qiagen) and 100 µl Dithiothreitol (0.1 M, DTT) (Sigma–Aldrich). Samples were incubated for 5 min at RT and then 140 µl of chloroform was added, vortexed, and incubated for an additional 3 min at RT. The mixture was then centrifuged at 4 °C for 20 min at 14,000 × g, 12 µl glycogen (5 ng/µl) (Thermo Fisher Scientific) was added to each collected supernatant, and miRNeasy® Mini (Qiagen) Kit was used to purify the RNA including miRNAs. Elution was performed with 15 µl of RNase-free water and quantification was performed using NanoDrop™ 2000c Spectrophotometers (Thermo Fisher Scientific). RNA quality was randomly checked using a Bioanalyzer 2100 instrument (Agilent Technologies).
5
Total RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction was performed with miRNeasy mini or miRNeasy FFPE Kit (both Qiagen, Hilden, Germany). RNA was quantified using Nanodrop 1000 spectrophotometer (Thermo Scientific, Waltham MA, U.S.A.). Assessment of RNA degradation was performed via Agilent 2100 Bioanalyzer and RNA 6000 Nano Assay (Agilent Technologies, Santa Clara CA, U.S.A.). cDNA was synthesized using random hexamer primers and Omniscript Reverse Transcription Kit (Qiagen). Two independent cDNA syntheses were pooled for each sample. In order to detect FGFR knock-down after transfection of specific siRNAs the High-Capacity RNA-to-cDNA™ Kit (Life Technologies, Carlsbad CA, U.S.A.) was used for cDNA synthesis.
6
Pig Cardiovascular miRNA Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LV samples (30 mg) underwent miR extraction (miRNeasy Mini cat # 217084, Qiagen, Valencia, CA) and the miR pool checked for quality (Agilent RNA 6000 Nano Kit Santa Clara, CA). The miR pool was then reverse transcribed (miScript II RT HiSpec Kit cat # 218161, Qiagen, Valencia, CA). This study utilized a custom pig cardiovascular miR array (cat # 331221, MIHS-113Z, Qiagen, Valencia, CA), which contained 84 individual miRs. The resulting cDNA from miRs was used for SYBR Green PCR (miScript SYBR Green PCR Kit cat # 218073, Qiagen, Valencia, CA). Quantitative RT-PCR was performed (Bio-Rad CFX96 Touch) according to the vendor protocol. The maximum threshold cycle (CT) for detection was set at 35 CTs. CT values of the mean for SNORD42B, SNORD69, SNORD61, SNORD68, SNORD96A, and RNU6-6P were used as reference values for normalization.
7
ELMO1 CRISPR Plasmid Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ELMO1 gRNA: ELMO1-CRISPR-for#1: TAGGTGGCCATCGAGTGGCCTG (underlined region is the gRNA target site) and ELMO1-CRISPR-rev#1: AAACCAGGCCACTCGATGGCCACC, oligos were cloned into the plasmid, pUC19 (Addgene)29 (link). BamHI-HF (Biolabs) was used for pUC19-linearisation. Cas9 mRNA was synthesised from pT3TS30 (link) [Addgene] after linearising with XbaI (Biolabs). Plasmids were purified with the PCR purification kit (Qiagen). In vitro transcription was done by T7 MEGAshortscript kit (Invitrogen) (control and ELMO1 gRNA) and mMESSAGE MACHINE Kit (Invitrogen) (Cas9 mRNA). Purification of RNA after TURBO DNAse treatment was done via the MiRNeasy Mini (Qiagen) and RNeasy Mini (Qiagen) kits.
8
Sequencing of small 5′‐triphosphate‐containing RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small RNA (< 200 nt) was purified from 5 × 107 cells using a combination of miRNeasy Mini (Qiagen) and RNeasy® MinElute® Cleanup (Qiagen) following the instructions of the manufacturer. Two micrograms of small RNA was treated with 1 unit of Terminator™ 5′‐Phosphate‐Dependent Exonuclease (TEX, Epicentre) in 1× Terminator Reaction Buffer B for 30 min at 42°C to remove 5′‐monophosphate RNA. Next, the RNA was purified and one half (+5′‐polyphosphatase) was treated with 20 units RNA 5′‐polyphosphatase to convert 5′‐triphosphate RNA to 5′‐monophosphate RNA. The second half (−5′‐polyphosphatase) was left untreated and served as a control. The sequencing libraries were constructed using the NEBNext® Multiplex Small RNA Library Prep Set for Illumina® (New England BioLabs) and sequenced on an Illumina® NextSeq 500.
9
Intimal RNA Isolation from Murine Aorta
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Intimal RNA isolation was performed according to Nam et al. (2009) (link). In brief, C57BL/6 mice were euthanized and perfused with saline through the left ventricle. Aortic sections between the arch and thoracic region were isolated and cleared of periadventitial tissue before eluting the endothelium with 250 µl of QIAzol (QIAGEN) perfused through an insulin syringe. RNA from the endothelium and remaining media were then isolated and amplified with miRNeasy mini using whole transcriptome amplification kits (QIAGEN) according to the manufacturer’s instructions. cDNA was then used for real-time quantitative PCR in a real-time PCR detection system (CFX96; Bio-Rad Laboratories) using iQ-SYBRGreen supermix (Bio-Rad Laboratories). VEGFR3 was amplified with QIAGEN primer set QT01744848. Other primers include SMA Fwd, ATCGTCCACCGCAAATGC; and Rev, AAGGAACTGGAGGCGCTG; SM22 Fwd, GCGCCTGGGCTTCCA, and Rev, CAGGCTGTTCACCAATTTGCT; VECAD Fwd, CACTGCTTTGGGAGCCTTC, and Rev, GGGGCAGCGATTCATTTTTCT; and B2M Fwd, CCGAGCCCAAGACCGTCTA, and Rev, AACTGGATTTGTAATTAAGCAGGTTCA. The normalized ratios of messages within the endothelial elutes from individual aortas were then quantified and graphed in Prism (GraphPad Software).
10
Muscle-Specific miRNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quadriceps muscles were collected into RNAlater Solution (Ambion) and stored at 4°C until all experimental samples were collected (up to 28 days). A 25mg section of the mid belly of the quadriceps was cut for further processing. miRNA and mRNA were extracted from this muscle section using the miRNeasy Mini and RNeasy MinElute Cleanup kits (Qiagen). miRNA was analyzed using TaqMan Small RNA Assays (Applied Biosystems: catalog # 002222, 002246, 002247, 000510, 001973) and ViiA7 Real-Time PCR System (Applied Biosystems; Thermo Fisher). cDNA was synthesized from mRNA using Superscript III reverse transcriptase (Thermo Fisher), and analyzed by quantitative RT-PCR using SYBR green on the ViiA7. Gene expression levels relative to U6 small nuclear RNA and β-actin for miRNA and mRNA, respectively were quantitated using the 2^(-ΔΔCT) method. Canonical muscle miR-1, -133a, -133b and -206 were investigated. Validated target genes of these muscle specific miRNAs (shown in Table 1 ) were chosen due to their reported roles in muscle. Primer sequences used in this study are listed in S1 Table .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!