S3 cell sorter

Four million cells were washed with PBS (Gibco, 14190094) and the pellet was resuspended in 300 μl PBS. Next, 700 μl of 70% ice-cold ethanol was added dropwise while vortexing to fix the cells. Cells were stored at −20°C for at least 1 h. After incubation, cells were washed with PBS and the pellet was resuspended in 1 ml PBS containing RNAse A (Qiagen, 19101) at a final concentration of 0.2 mg/ml. After 1 h incubation at 37°C, propidium iodide (BD biosciences, 556463) was added to a final concentration of 40 μg/ml. Samples were loaded on a S3 cell sorter (Bio-Rad) and analyzed using the FlowJo v.10 software.

Fibroblasts were seeded at low density so the single cells could be separated from each other on microscopic images. Phase-contrast photographs of the cells were made using EVOS FL AUTO the day after seeding. The PHANTAST FiJi plugin [71 ] was used to segment cells on the images. Holes in binary masks were filled and shapes were analyzed with the standard FiJi function ‘Analyse particles’. The following parameters were analyzed: area, perimeter, bounding rectangle (width, height and aspect ratio), fit ellipse (major and minor axes), circularity, roundness, solidity and caliper diameter (max and min). The estimation of cell size and granularity was made by analyzing forward (FSC) and side (SSC) scatter from flow cytometry data from a Bio-Rad S3 Cell Sorter (Bio-Rad, Hercules, CA, USA).

Rat BMSCs at passage 1 were detached from the cell culture flask by Accutase (Innovative Cell Technologies, San Diego, CA, United States). After washing with phosphate-buffered saline (PBS), the cells were stained with antibodies against CD45 (AbD Serotec, Raleigh, NC, United States), CD73 (BD Biosciences, San Jose, CA, United States), CD90 (BioLegend, San Diego, CA, United States), and CD106 (BioLegend, San Diego, CA, United States). The stained cells were analyzed by flow cytometry with an S3 Cell Sorter (Bio-Rad, Hercules, CA, United States).

Cells were incubated with disaggregated 200 nM FITC-labelled Aβ_1–42 peptide (Bachem, Bubendorf, Switzerland): 5, 10, 15, and 30 min and 1, 3, 18, and 24 h. Cells were trypsinized, washed, and resuspended in PBS (Gibco, Life Technologies, Paisley, UK), and the fluorescence signal was measured by flow cytometry (S3 Cell Sorter (Bio-Rad Laboratories, Hercules, CA)) using 488 nm laser excitation. 5000 cells were analyzed, and fluorescence signals were plotted in Kaluza software (version 1.3) (Beckman Coulter Inc., Indianapolis, IN, USA) as FL1-area log against the signal count for the detection of the shift of fluorescence signal compared to the unstained cells. Cells used in this experiment were nondifferentiated. For all other experiments, differentiation of cells was induced using retinoic acid.

TCam-2 cell line was kindly provided by Professor Sohei Kitazawa and Janet Shipley and was maintained in advanced RPMI 1640 (GIBCO, 12633) supplemented with 10% fetal bovine serum, 100U/ml Penicillin-0.1 mg/ml Streptomycin and 2mM L-Glutamine.
To suppress the expression of SOX17 in TCam-2, we used inducible expression vector containing miRNA against SOX17 into TCam-2. microRNA (miR) were designed by BLOCK-iT RNAi Designer (http://rnaidesigner.lifetechnologies.com/rnaiexpress/). miR sequence for SOX17 miR-1 were Fw: 5′- TTCAAATTCCGTGCGGTCCACGTTTTGGCCACTGACTGACGTGGACCGCGGAATTTGAA-3′; for SOX17 miR-2 were Fw: 5′- TGCAGATACTGTTCAAATTCCGTTTTGGCCACTGACTGACGGAATTTGCAGTATCTGCA-3′. As a control, non-targeting miR was previously designed (Hackett et al., 2013 (link)). These miRs were cloned into a vector downstream of a tetracycline response element (TRE). The vectors were co-transfected with vector containing the reverse tetracycline transactivator (rtTA) with Venus, a gene encoding a variant of yellow fluorescent protein. Transfected TCam-2 were cultured 3 days in the presence of doxycycline (Sigma). After culture, Venus positive cells were collected by S3 Cell Sorter (Bio-Rad) and resuspended in lysis buffer for RNA extraction.

To construct C-terminally enhanced GFP-tagged TcCyP22 for localization in T. cruzi, the full-length cDNA of TcCyP22 was amplified from T. cruzi genomic DNA (Y strain) by PCR using the forward primer 5′-
CCCTCTAGAATGTTTTCTCGTACATGGTTTTGGG-3′ and the reverse primer 5′-
CGAAGCTTGTTGTTTTTGACTTCACCACAGTCC-3′ (where the underlined nucleotides indicate the introduced XbaI and HindIII restriction sites, respectively). The PCR product was digested with XbaI and HindIII and then cloned in frame into the insertion sites in the pTREX-eGFP vector.^{30 (link)} The double-stranded sequences of GFP-tagged TcCyP22 constructs were confirmed as correct by DNA sequencing. The pTREX-TcCyP22-GFP DNA was transfected into T. cruzi epimastigotes, Y strain by electroporation in Cytomix buffer at 1.5 kV with 3 pulses 25 μF, ∞ resistance each and selected with 250 μg/ml G418 antibiotic, for 2 weeks approximately. Enrichment of parasites expressing TcCYP22-GFP or GFP (from parasites carrying the empty pTREX-GFP, used as control parasites) was performed by GFP⁺ sorting using a Bio-Rad S3 cell sorter, Hercules, CA, USA.