General tissue culture materials were obtained from VWR International. Antibodies against BRD2 (ab139690), BRD3 (ab50818), BRD4 (ab128874) and IRF1 (ab26109) antibody for chromatin immunoprecipitation (ChIP) were obtained from Abcam. Antibodies against c-MYC (5605), human PD-L1 (E1L3N clone; 13684), IRF1 (8478) and control IgG (2729) antibody for ChIP were purchased from Cell Signaling Technology. Anti-BRD4 (A301–985A) antibody for ChIP was obtained from Bethyl Laboratories. PE-conjugated human PD-L1 (MIH1 clone; 12-5983-42) antibody was from Thermo Fisher. The GAPDH (MAB374) antibody was from Millipore, and α-tubulin (sc-8035) antibody and HSP90 (sc-7940) antibody were obtained from Santa Cruz Biotechnology. Secondary anti-mouse IgG (A4416) and anti-rabbit IgG (A6667) antibodies were purchased from Sigma. The BET inhibitors JQ1 and I-BET151 were obtained from Tocris Bioscience, the BET PROTAC ARV-825 was obtained from MedChem Express, and human and mouse IFN-γ was purchased from Thermo Fisher Scientific. The siRNAs against BRD2, BRD3, BRD4, c-MYC, and IRF1 were purchased from Thermo Fisher Scientific.
Ab139690
Manufactured by Abcam
Sourced in United Kingdom
Ab139690 is a recombinant protein produced in E. coli. It represents a fragment of the human PRKACA protein.
Automatically generated - may contain errors
Lab products found in correlation
Ab128874, by Abcam (5 mentions)
Ab50818, by Abcam (4 mentions)
Odyssey sa imaging system, by LI COR (2 mentions)
Image studio software version 5, by LI COR (2 mentions)
Anti rabbitirdye 800cw secondary antibody, by LI COR (2 mentions)
Ab8227, by Abcam (2 mentions)
Ab26109, by Abcam (1 mentions)
General tissue culture materials, by Avantor (1 mentions)
Gapdh mab374 antibody, by Merck Group (1 mentions)
Anti rabbit igg a6667, by Merck Group (1 mentions)
I bet151, by Bio-Techne (1 mentions)
Sirnas against, by Thermo Fisher Scientific (1 mentions)
Ab205606, by Abcam (1 mentions)
Reblot plus strong antibody stripping solution, by Merck Group (1 mentions)
Trans blot turbo transfer system, by Bio-Rad (1 mentions)
Ab216773, by Abcam (1 mentions)
Nitrocellulose membrane, by Merck Group (1 mentions)
Bca assay, by Thermo Fisher Scientific (1 mentions)
Ab216774, by Abcam (1 mentions)
Benzonase nuclease, by Merck Group (1 mentions)
6 protocols using ab139690
1
Chromatin immunoprecipitation protocol for BRD proteins
2
Western Blot Analysis of Bromodomain Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Blots were probed with antibodies for Brd4 (AbCam ab128874, 1:1,000 dilution), Brd3
(AbCam ab50818, 1:500 dilution), Brd2 (AbCam ab139690, 1:2,000 dilution),
β-actin (AbCam ab8227, 1:2,000 dilution) and cMyc (AbCam ab32072, 1:1,000
dilution) antibodies. Blots were developed with anti-Mouse or anti-Rabbit
IRDye® 800CW secondary antibody from Licor (1:10,000 dilution) and bands
visualized using Licor Odyssey Sa imaging system. Image processing and band
intensity quantification were done using Licor Image Studio software Version
5.2.5. Ubiquitination blots were probed with anti-6×His antibody (AbCam
ab18184, 1:2,000 dilution) and then with anti-Mouse IgG, HRP-linked antibody
(Cell Signaling Technology #7076, 1:2,000 dilution). Probed blots were
visualised with ECL Western Blotting Substrate (Pierce #32106) on film.
(AbCam ab50818, 1:500 dilution), Brd2 (AbCam ab139690, 1:2,000 dilution),
β-actin (AbCam ab8227, 1:2,000 dilution) and cMyc (AbCam ab32072, 1:1,000
dilution) antibodies. Blots were developed with anti-Mouse or anti-Rabbit
IRDye® 800CW secondary antibody from Licor (1:10,000 dilution) and bands
visualized using Licor Odyssey Sa imaging system. Image processing and band
intensity quantification were done using Licor Image Studio software Version
5.2.5. Ubiquitination blots were probed with anti-6×His antibody (AbCam
ab18184, 1:2,000 dilution) and then with anti-Mouse IgG, HRP-linked antibody
(Cell Signaling Technology #7076, 1:2,000 dilution). Probed blots were
visualised with ECL Western Blotting Substrate (Pierce #32106) on film.
3
Western Blot Analysis of Bromodomain Proteins
4
Western Blot Optimization and Antibody Validation
5
Western Blot Analysis of Bromodomain Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were seeded (HEK293: 1
× 105 cells/well) in 12-well plates. Following compound
treatment, cells were lysed on ice with RIPA lysis and extraction
buffer (Thermo Fisher Scientific, 89901) supplemented with protease
inhibitor cocktail (Merck, 11697498001) and Benzonase Nuclease (Sigma-Aldrich,
E1014). Protein concentration was determined using the BCA assay (Thermo
Fisher Scientific, 23225). Samples were then prepared and loaded onto
NuPAGE 4–12% Bis–Tris Midi gels (Thermo Fisher Scientific,
WG1403A) followed by the transfer of the proteins onto nitrocellulose
membranes (EMD Millipore). The membranes were blocked for 1 h prior
to incubation with the primary antibodies using 5% Milk TBST. Membranes
were probed for Brd2 (Abcam, Ab139690, 1:1000), Brd3 (Abcam, Ab50818,
1:4000), and Brd4 (Abcam, Ab128874, 1:1000). Following overnight incubation
with the primary antibodies at 4 °C, the membranes were incubated
with secondary antibodies (Anti-rabbit, Abcam AB216773, 1:5000 or
antimouse, Abcam AB216774, 1:5000) and hFAB Rhodamine Anti-Tubulin
Antibody (Bio-Rad, 12004165, 1:10 000) for 1 h and then imaged
with a Bio-Rad imager (LI-COR Biosciences). All Western blots were
analyzed for band intensities using Image Lab from Bio-Rad (LI-COR
Biosciences). The data extracted from these blots were then subsequently
plotted and analyzed using Prism (v. 8.2.1, GraphPad).
× 105 cells/well) in 12-well plates. Following compound
treatment, cells were lysed on ice with RIPA lysis and extraction
buffer (Thermo Fisher Scientific, 89901) supplemented with protease
inhibitor cocktail (Merck, 11697498001) and Benzonase Nuclease (Sigma-Aldrich,
E1014). Protein concentration was determined using the BCA assay (Thermo
Fisher Scientific, 23225). Samples were then prepared and loaded onto
NuPAGE 4–12% Bis–Tris Midi gels (Thermo Fisher Scientific,
WG1403A) followed by the transfer of the proteins onto nitrocellulose
membranes (EMD Millipore). The membranes were blocked for 1 h prior
to incubation with the primary antibodies using 5% Milk TBST. Membranes
were probed for Brd2 (Abcam, Ab139690, 1:1000), Brd3 (Abcam, Ab50818,
1:4000), and Brd4 (Abcam, Ab128874, 1:1000). Following overnight incubation
with the primary antibodies at 4 °C, the membranes were incubated
with secondary antibodies (Anti-rabbit, Abcam AB216773, 1:5000 or
antimouse, Abcam AB216774, 1:5000) and hFAB Rhodamine Anti-Tubulin
Antibody (Bio-Rad, 12004165, 1:10 000) for 1 h and then imaged
with a Bio-Rad imager (LI-COR Biosciences). All Western blots were
analyzed for band intensities using Image Lab from Bio-Rad (LI-COR
Biosciences). The data extracted from these blots were then subsequently
plotted and analyzed using Prism (v. 8.2.1, GraphPad).
6
Chromatin Immunoprecipitation Analysis of BRD2-RasGRP1 Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Nuclear Extraction Kit (Active Motif, Carlsbad, CA, USA) was used for the preparation of nuclear extracts following the manufacturer's protocol. The nuclear lysate products were subjected to immunoprecipitation using a commercially available ChIP assay kit (Abcam, Cambridge, London, UK) with the following antigens: rabbit anti‐BRD2 antibody (1:50; ab139690; Abcam) and non‐specific IgG (1:200; ab108338; Abcam). The specific immunoprecipitated promoter fragments was amplified by PCR and visualized by agarose gel electrophoresis. The following primer pairs were used in ChIP: 5′‐TGGTGTCGTGTGGTGCGACCACAT‐3′ (forward) and 5′‐CGCTGCTGAGCTGTCAGCGGAGGA‐3′ (reverse). The putative binding site sequence of E2F‐1/BRD2 complex in RasGRP1 promoter was projected by online PROMO algorithm analysis (http://alggen.lsi.upc.es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDB=TF_8.3 ) [25 , 26 ].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!