Log In Sign up
The largest database of trusted experimental protocols

Iscript one step reverse transcription pcr kit

Manufactured by Bio-Rad
Visit Supplier
Sourced in United States

The IScript One-Step Reverse-Transcription PCR Kit is a laboratory equipment product that enables efficient and reliable reverse transcription and amplification of RNA targets in a single reaction. It provides the necessary components for cDNA synthesis and real-time PCR detection.

Automatically generated - may contain errors

Lab products found in correlation

Sybr green, by Bio-Rad (3 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Rneasy kit, by Qiagen (2 mentions)

Spelling variants of this product

IScript (787 citations) IScript kit (577 citations) IScript reverse transcription kit (191 citations) Reverse transcription kit (76 citations) IScript Reverse Transcription (36 citations) One-Step iScript kit (3 citations)

3 protocols using iscript one step reverse transcription pcr kit

1

Quantification of IL-12 Expression in Primary Keratinocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from primary KCs was isolated with TRIzol reagent. Real-time RT-PCR was performed with iScript™ One-Step reverse transcription–PCR Kit with SYBR® Green following the manufacturer’s instructions (BioRad). The sequences of the primers used are as follows: m-IL12-FW, 3′-GGAAGCACGGCAGCAGAATA-5′; m-IL12-RV, 3′-AACTTGAGGGAGAAGTAGGAATGG-5′; m-b-Actin-FW, 3′- GACGGCCAGGTCATCACTAT-5′; m-b-Actin-RV, 3′- CGGATGTCAACGTCACACTT-5′.
de Mingo Pulido Á., de Gregorio E., Chandra S., Colell A., Morales A., Kronenberg M, & Marí M. (2018). Differential Role of Cathepsins S and B In Hepatic APC-Mediated NKT Cell Activation and Cytokine Secretion. Frontiers in Immunology, 9, 391.
+ Open protocol
+ Expand
2

Quantifying Colonic Gene Expression in Rats

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from rat colon crypt aliquots was isolated using the Trizol (Life Technologies, Grand Island, NY, US) and RNeasy kit (Qiagen, Hilden, Germany). qPCR was performed using the Bio-Rad iScript One-Step Reverse-Transcription PCR Kit with SYBR Green (Bio-Rad, Hercules, CA, US) using the following specific primers from Integrated DNA Technologies (Coralville, IA, US): claudin-1: forward-ATGACCCCTATCAATGCCAG, reverse-TGGTGTTGGGTAAGAGGTTG; claudin-2: forward-CAGCTCCGTTTTCTAGATGCC, reverse-TGCGGCTCTTGTTTCTTGGA; occludin: forward-AAAGCAGGGAAGGCGAAG, reverse-TGTTGATCTGAAGTGATAGGTGG; GR: forward- GCGTCAAGTGATTGCAGCAGTGAA, reverse-GCAAAGCAGAGCAGGTTTCCACTT; GAPDH: forward-TGTGAACGGATTTGGCCGTA, reverse-TGAACTTGCCGTGGGTAGAG.
Zong Y., Zhu S., Zhang S., Zheng G., Wiley J.W, & Hong S. (2018). Chronic Stress and Intestinal Permeability: Lubiprostone Regulates Glucocorticoid Receptor-mediated Changes in Colon Epithelial Tight Junction Proteins, Barrier Function and Visceral Pain in The Rodent and Human. Neurogastroenterology and motility : the official journal of the European Gastrointestinal Motility Society, 31(2), e13477.
+ Open protocol
+ Expand
3

Colon Epithelial RNA Extraction and qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated epithelial cells scrapped from colon lumen using the Trizol (Life Technologies, Grand Island, NY, US) and RNeasy kit (Qiagen, Hilden, Germany). qPCR was performed using the Bio-Rad iScript One-Step Reverse-Transcription PCR Kit with SYBR Green (Bio-Rad, Hercules, CA, US) using the following specific primers from Integrated DNA Technologies (Coralville, IA, US): NR3C1: forward- GCGTCAAGTGATTGCAGCAGTGAA, reverse-GCAAAGCAGAGCAGGTTTCCACTT; CLDN1: forward-AGGCAACCAGAGCCTTGATGGTAA, reverse-CATGCACTTCATGCCAATGGTGGA; GAPDH: forward-ACAAGATGGTGAAGGTCGGTGTGA, reverse-AGCTTCCCATTCTCAGCCTTGACT.
Zheng G., Victor Fon G., Meixner W., Creekmore A., Zong Y., K. Dame M., Colacino J., Dedhia P.H., Hong S, & Wiley J.W. (2017). Chronic stress and intestinal barrier dysfunction: Glucocorticoid receptor and transcription repressor HES1 regulate tight junction protein Claudin-1 promoter. Scientific Reports, 7, 4502.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!