Amv first strand cdna synthesis kit

Manufactured by Roche

Sourced in France, Spain, Switzerland

The AMV First Strand cDNA Synthesis Kit is a laboratory product designed to convert RNA into complementary DNA (cDNA) using the Avian Myeloblastosis Virus (AMV) reverse transcriptase enzyme. The kit provides the necessary components to perform this RNA-to-cDNA conversion process.

Automatically generated - may contain errors

Lab products found in correlation

Lightcycler 480 system, by Roche (2 mentions) Rneasy mini kit, by Qiagen (2 mentions) Cfx real time pcr detection system, by Bio-Rad (2 mentions) Trizol reagent, by Merck Group (2 mentions) Magna pure lc rna isolation kit high performance, by Roche (1 mentions) Upl probe, by Roche (1 mentions) Absolute qpcr mix, by Thermo Fisher Scientific (1 mentions) Light cycler 480 software 1, by Roche (1 mentions) Trizol rna isolation kit, by Thermo Fisher Scientific (1 mentions) Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions) Rnase free dnase, by Qiagen (1 mentions) Sybr green ex taq, by Takara Bio (1 mentions) Quantitative real time rt pcr analysis kit, by Bio-Rad (1 mentions) Nanodrop, by Roche (1 mentions) Lightcycler 480, by Roche (1 mentions) Lightcycler 480 sybr green 1 master mix, by Roche (1 mentions) Magna pure lc 2.0 instrument, by Roche (1 mentions)

8 protocols using amv first strand cdna synthesis kit

Quantifying Endothelin Receptor Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA expression of genes encoding endothelin receptor type A (Ednra) and type B (Ednrb) was analyzed in mouse thoracic aorta by Quantitative Real-Time PCR (qPCR). RNA was isolated using MagNA Pure LC RNA Isolation Kit High Performance (Roche), and reverse transcribed using AMV First Strand cDNA Synthesis Kit for reverse transcription (RT)-PCR (Roche). qPCR was performed on a LightCycler 480 system (Roche) according to the manufacturer’s protocol with reaction mixtures containing 2.5 μl cDNA, 0.4 μmol/L of each primer (Life Technologies), 100 nmol/L UPL probe (Roche) and 10 μl Absolute qPCR mix (Thermo Scientific) in a total volume of 20 μl. Primer (shown in 5′ → 3′orientation)/probes were designed using the Roche Universal Probe Library Assay Design Center:
mEdnra GGGCATCACCGTCTTGAA/GGAAGCCACTGCTCTGTACC, probe UPL#99, mEdnrb TCAGAAAACAGCCTTCATGC/GCGGCAAGCAGAAGTAGAA, probe UPL#83, mHprt TGATAGATCCATTCCTATGACTGTAGA/AAGACATTCTTTCCAGTTAAAGTTGAG, probe UPL#22. QPCR data were analyzed and quantified using the second derivative maximum for Cp determination, with the LightCycler 480 software 1.5.0 (Roche).

Amraoui F., Spijkers L., Hassani Lahsinoui H., Vogt L., van der Post J., Peters S., Afink G., Ris-Stalpers C, & van den Born B.J. (2014). SFlt-1 Elevates Blood Pressure by Augmenting Endothelin-1-Mediated Vasoconstriction in Mice. PLoS ONE, 9(3), e91897.

+ Open protocol

+ Expand

RNA Extraction from Mouse Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

Frozen human thymus, mouse spleen and tibialis anterior muscle were homogenized with the FastPrep FP120 instrument (Qbiogen, Illkirch, France). Total RNA was extracted from the thymus, spleen and muscle samples using a TRIzol RNA isolation kit (Invitrogen, Cergy-Pontoise, France). Total mRNA (1 μg) was reverse transcribed using the AMV first-strand cDNA Synthesis Kit (Roche Diagnostics, Meylan, France) according to the manufacturer’s instructions.

Villegas J.A., Van Wassenhove J., Merrheim J., Matta K., Hamadache S., Flaugère C., Pothin P., Truffault F., Hascoët S., Santelmo N., Alifano M., Berrih-Aknin S., le Panse R, & Dragin N. (2023). Blocking interleukin-23 ameliorates neuromuscular and thymic defects in myasthenia gravis. Journal of Neuroinflammation, 20, 9.

+ Open protocol

+ Expand

Quantitative PCR for Gene Expression

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

qPCR was performed as previously described [21 (link)]. Total RNA was isolated using RNeasy Mini Kit (Qiagen) according to manufacturer's protocol. Contaminating genomic DNA was eliminated using RNase-free DNase (Qiagen). Total RNA (2μg) was reverse transcribed into single-stranded cDNA using the AMV First Strand cDNA synthesis kit (Roche) according to the manufacturer's instructions. Real-time PCR amplification reactions were performed using the SYBR Green PCR Master Mix (Applied Biosystems). The cycling conditions and the primers used to amplify IRS-1, IRS-4, and 18S have been described previously [18 (link)].

Sanmartín-Salinas P, & Guijarro L.G. (2018). Overexpression of IRS-4 Correlates with Procaspase 3 Levels in Tumoural Tissue of Patients with Colorectal Cancer. Journal of Oncology, 2018, 3812581.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was isolated from 50 blastocysts using TRIzol reagent, and quantitative reverse transcription polymerase chain reaction (RT-qPCR) was performed using a Quantitative Real-Time RT-PCR Analysis Kit (Bio-Rad, Munich, Germany). The complementary DNA was synthesized using 1 µg of RNA, oligo (dT) primers, and the AMV First Strand cDNA Synthesis Kit (ROCHE). The quantitative PCR amplification was performed using SYBR^® Green EX Taq™ (TaKaRa) and an RG-6000 Real-Time PCR detection system (Corbett Research Co., Mortlake, Australia). The samples were run in triplicate. The relative gene expression was calculated using the comparative threshold cycle (Ct) method, with GAPDH as the reference gene. The thermocycling conditions were as follows: 95 °C for 10 min; followed by 35 cycles at 95 °C for 10 s, 60 °C for 30 s, and 72 °C for 30 s. Fluorescence was measured once. Primer sets for each gene are listed in Table 1.

Hwang I.S., Shim J., Oh K.B., Lee H, & Park M.R. (2022). cd26 Knockdown Negatively Affects Porcine Parthenogenetic Preimplantation Embryo Development. Animals : an Open Access Journal from MDPI, 12(13), 1662.

+ Open protocol

+ Expand

Quantifying Neurological Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from 100-mg samples of fresh frozen temporal lobe using the RNeasy Mini Kit (Qiagen, Hilden, Germany). RNA was reverse transcribed using the AMV First Strand cDNA Synthesis Kit (Roche, Indianapolis, IL). The cDNA templates were used to measure RCAN1 and IDE by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) in a Roche LightCycler 480 System [106] (link). Primer pairs were designed using MacVector 12 software (Cary, NC) (Table 1). Relative mRNA abundance was calculated using the 2ˆ^ΔC_t method, with results normalized to actin or hypoxanthine phosphoribosyltransferase 1.Table 1

Primer pairs used for qRT-PCR analysis of human and rat IDE and RCAN genes

Primers	Direction	Sequence	Position	Amplicon
Human
IDE	Forward	TACCTCCGCTTGCTGATGAC	2110	106
IDE	Reverse	GGAGCTGAGGTATGAAGGCC	2215
RCAN1	Forward	AGGCTCCAGCTGCATAAGAC	258	111
RCAN1	Reverse	CTGCTTGTCTGGATTTGGCG	368
Rat
IDE	Forward	CTGTGCCCCTTGTTTGATGC	523	139
IDE	Reverse	TGAAGGGGTGCTTGGGATTC	661
RCAN1-2-3	Forward	AACTTCAGCAACCCCCTGTC	231	80
RCAN1-2-3	Reverse	AGTTTCATCTCCTTCCCCAGG	310

Abbreviations: IDE, Insulin-degrading enzyme; RCAN1, regulator of calcineurin 1; qRT-PCR, quantitative reverse transcriptase polymerase chain reaction.

Delikkaya B., Moriel N., Tong M., Gallucci G, & de la Monte S.M. (2019). Altered expression of insulin-degrading enzyme and regulator of calcineurin in the rat intracerebral streptozotocin model and human apolipoprotein E-ε4–associated Alzheimer's disease. Alzheimer's & Dementia : Diagnosis, Assessment & Disease Monitoring, 11, 392-404.

+ Open protocol

+ Expand

Real-Time PCR Gene Expression Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cultured cells or from whole kidney tissue using TRIzol reagent (Sigma, Madrid, Spain), and reverse transcription was performed with First Strand cDNA Synthesis Kit (AMV) (Roche) according to manufacturer’s instructions. Real-time PCR with gene-specific TaqMan probes was performed with a CFX Real-Time PCR detection system (Bio-Rad Laboratories, Madrid, Spain) using TaqMan Universal PCR Master Mix, No AmpErase UNG. Forty cycles at 95 °C for 15 s and 60 °C for 1 min were performed^{32 (link),55 (link)–57 (link)}. Relative mRNA levels were calculated by standard formulae (ΔΔCt method) using GAPDH or TBP as an endogenous control. The results referred to a randomly selected basal sample considered as value = 1.0. Gene-specific TaqMan probes used in this study are indicated in the Supplementary Methods.

Bozic M., Caus M., Rodrigues-Diez R.R., Pedraza N., Ruiz-Ortega M., Garí E., Gallel P., Panadés M.J., Martinez A., Fernández E, & Valdivielso J.M. (2020). Protective role of renal proximal tubular alpha-synuclein in the pathogenesis of kidney fibrosis. Nature Communications, 11, 1943.

+ Open protocol

+ Expand

Quantitative Analysis of Bone Regulatory Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells or mouse organs using TRIzol reagent (Sigma), and cDNA was synthesized with the First Strand cDNA Synthesis Kit (AMV) (Roche, Basilea, Switzerland) following the manufacturer’s instructions. Singleplex real-time PCR was performed with the CFX Real-Time PCR detection system (Bio-Rad) using the following specific TaqMan probes for murine samples (ThermoFisher, Waltham, MA, USA): FGF23 (Mm_00445621_m1), 1α-hydroxylase (Mm01165918_g1), RUNX2 (Mm00501584_m1), Osteopontin (Mm00436767_m1) and Osterix (Mm04933803_m1). Data were normalized to tbp (Mm00446971_m1, ThermoFisher) expression levels. The rt-PCR was performed using TaqMan Universal PCR Master Mix, No AmpErase UNG (ThermoFisher) with forty cycles at 95 °C for 15 s and 60 °C for 1 min. The mRNA copy numbers were calculated by standard formulae (ΔΔCt method). Results were normalized against TBP expression levels and are expressed as relative changes with respect to unstimulated cells or control mice.

Rayego-Mateos S., Doladé N., García-Carrasco A., Diaz-Tocados J.M., Ibarz M, & Valdivielso J.M. (2022). The Increase in FGF23 Induced by Calcium Is Partially Dependent on Vitamin D Signaling. Nutrients, 14(13), 2576.

+ Open protocol

+ Expand

Pituitary and Hypothalamic Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from pituitary, the PVN, and VMH punches were isolated using the MagNA Pure LC 2.0 Instrument (Roche Molecular Biochemicals) with Magna pure tissue III total RNA kit (Roche Molecular Biochemicals). RNA yield was determined using the Nanodrop (Nanodrop), and cDNA was synthesized with equal RNA input with the First-Strand cDNA synthesis kit (AMV) for qPCR with oligo-d (T) primers (Roche Molecular Biochemicals). As a control for genomic DNA contamination, a cDNA synthesis reaction without reverse transcriptase was included.
Quantitative PCR was performed using the LightCycler 480 (Roche Molecular Biochemicals) and LightCycler 480 SYBR Green I Master mix (Roche Molecular Biochemicals).
The primers used for qPCR are listed in Table 2. Quantification was performed using the LinReg software. PCR efficiency was checked individually and samples with a deviation of more than 5% of the mean were excluded from the analysis. Calculated values were related to the geometric mean expression of Gapdh and Hprt, reference genes showing stable expression under the experimental conditions.

Zhang Z., Bisschop P.H., Foppen E., van Beeren H.C., Kalsbeek A., Boelen A, & Fliers E. (2016). A model for chronic, intrahypothalamic thyroid hormone administration in rats. The Journal of endocrinology, 229(1).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!