Abi 7500 qpcr instrument

Total RNA from rat myocardial tissues was extracted with TRIzol reagents (Invitrogen, Carlsbad, CA, USA). After measuring the RNA concentration with NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA), cDNA synthesis and reaction were performed in a polymerase chain reaction (PCR) amplifier (Thermo Fisher Scientific). RT-qPCR was processed using an ABI7500 qPCR instrument (Thermo Fisher Scientific) under the following conditions: pre-denaturation at 95°C for 10 min and then 45 PCR cycles of denaturation at 95°C for 15 s, annealing at 60°C for 1 min, and extension at 72°C for 10 s. Primers are listed in Table 1 [28 (link),29 (link)]. Quantification was performed with the 2^−ΔΔCt method [30 (link)], with the relative expression normalized to U6 or glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Extraction of total RNA was done using the BioZOL reagent (Hangzhou Bioer Technology Co., Ltd, Hangzhou, China), according to the manufacturer’s instructions. The RNA samples’ purity and concentration were determined using the spectrophotometer NanoDrop2000 (Thermo Fisher Scientific, USA). The reverse transcription of the RNA into complementary DNA (cDNA) was done using SYBR Prime Script™ RT-PCR kit (Sigma, St Louis, MO, USA) following the manufacturer’s instruction. Primer 5.0 software was utilized to design the primers, which were synthesized by Takara. The primer-specific sequences are described in Table 1. The RT-qPCR was done using the ExScript™ RT-PCR kit (Takara Holdings, Kyoto, Japan) and the ABI7500 qPCR instrument (Thermo Fisher Scientific, USA). U6 was considered a loading control for miR-103a-3p, with GAPDH for CXCL12. Gene expression data were calculated using the 2^−ΔΔCq method.
Table 1.

Primer design

Name	Primer sequences (5’-3’)
MiR-103a-3p	F: AGCAGCAUUGUACAGGGCUAUGA
	R: AUAGCCCUGUACAAUGCUGCUUU
CXCL12	F: TGCATCAGTGACGGTAAACCA
	R: CACAGTTTGGAGTGTTGAGGAT
U6	F: GCTTCGGCAGCACATATACTAAAAT
	R: CGCTTCACGAATTTGCGTGTCAT
GAPDH	F: TATGATGATATCAAGAGGGTAGT
	R: TGTATCCAAACTCATTGTCATAC

miR, microRNA; CXCL12, C-X-C motif chemokine 12; F, forward, R; reverse.

Total RNA was extracted from tissues or cells of 4 mice in each group using TRIZOL reagent (Invitrogen, Carlsbad, CA, USA). The primers for miR-23b and Nrf2 were provided by Invitrogen (Table S1). The total RNA was reversely transcribed into complementary DNA based on the instructions of different RT kits such as TaqMan™ MicroRNA Reverse Transcription Kit (4366596; Thermo Fisher Scientific) and High-Capacity cDNA (4368813; Thermo Fisher Scientific). RT-qPCR experiments were performed on ABI7500 qPCR instrument (Thermo Fisher Scientific) the SYBR^® Premix Ex Taq^TM (Tli RNaseH Plus) kit (RR820A,TaKaRa, Tokyo, Japan) on a real-time fluorescent quantitative PCR instrument (ABI, Foster City, CA, USA) with the 25 µL reaction system. The PCR reaction conditions were as follows: pre-denaturation at 95 °C for 5 min, 40 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 20 s and extension at 72 °C for 20 s, and extension at 78 °C for 20 s. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Invitrogen) was utilized as internal reference for Nrf2 and U6 (Invitrogen) for miR-23b. The relative expression was analyzed using 2^-ΔΔCt method. ΔΔCt = (mean Ct value of the target gene of the experimental group - mean Ct value of GAPDH of the experimental group) - (mean Ct value of the target gene of the control group - mean Ct value of GAPDH of the control group).

Trizol reagent (Invitrogen Inc., Carlsbad, CA) was applied for total RNA extraction from tissues and cells, followed by concentration determination by NanoDrop 2000 software (Thermo). Then, reverse transcription (RT) protocol was carried out with the PrimeScript™ RT reagent kit with the gDNA Eraser kit (RRO37A, Takara Holdings Inc., Kyoto, Japan). Next, real-time quantitative polymerase chain reaction (qPCR) was employed with the use of the SYBR® Premix Ex Taq™ (Tli RNaseH Plus) kit (RR820A, Takara) combined with ABI7500 qPCR instrument (Thermo Fisher Scientific Inc., Waltham, MA). The relative quantification value for the target genes normalized to the expression pattern of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was identified by the 2^-ΔΔCt method [23 (link)]. All used primers provided by GenePharma Co., Ltd., (Shanghai, China) are shown in Table S1.

qRT-PCR was performed as described in a previous study 20 . The total RNA was isolated from cell and tissue samples using TRIzol reagent. The cDNA synthesis was performed using the PrimeScript RT reagent kit and the PrimeScript miRNA cDNA Synthesis kit (TaKaRa, Dalian, China). qRT-PCR was performed using the SYBR Premix Ex Taq II kit (TaKaRa) with an ABI 7500 qPCR instrument (ThermoFisher Scientific). U6 and GAPDH were used as internal controls. The relative expression of miRNA or mRNAs was evaluated by the 2^-ΔΔCt method. The primer sequences are provided in Table S2.