Total RNA was extracted from Drosophila larvae, adults or salivary glands using an RNA extraction kit according to the manufacturer’s instructions (DP431; TIANGEN, Beijing, China). The total RNA concentration was measured using a NanoDrop 2000c, and 1 µg of total RNA was then used for cDNA synthesis (KR106; TIANGEN). 2×SYBR green master mix (ABI, 4367659) was added to the RNA extract for quantitative real-time PCR analysis using a LightCycler 480 instrument and software (Roche, Basel, Switzerland).
Dp431
Manufactured by Tiangen Biotech
Sourced in China
The DP431 is a laboratory centrifuge designed for general-purpose applications. It features a fixed-angle rotor with a capacity of up to 4 x 100 mL. The centrifuge operates at a maximum speed of 4,000 rpm and can achieve a maximum RCF of 2,000 x g. The DP431 is equipped with an easy-to-use control panel and safety features to ensure reliable and efficient operation in the laboratory setting.
Automatically generated - may contain errors
Lab products found in correlation
Kr106, by Tiangen Biotech (1 mentions)
Lightcycler 480, by Roche (1 mentions)
Animal tissue rna extraction kit, by Tiangen Biotech (1 mentions)
Superreal premix color, by Tiangen Biotech (1 mentions)
Fastquant rt kit with gdnase, by Tiangen Biotech (1 mentions)
Real time system, by Thermo Fisher Scientific (1 mentions)
Hiscript 2 q rt supermix for qpcr gdna wiper, by Vazyme (1 mentions)
Chamq sybr color qpcr master mix, by Vazyme (1 mentions)
Qps 201, by Toyobo (1 mentions)
Fsq 201, by Toyobo (1 mentions)
A3500, by Promega (1 mentions)
Gotaq qpcr mix kit, by Promega (1 mentions)
Cfx384, by Bio-Rad (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Abi 7500, by Takara Bio (1 mentions)
Sybr premix ex taqtm 2, by Takara Bio (1 mentions)
First strand cdna synthesis kit, by Takara Bio (1 mentions)
Cfx96 real time system, by Bio-Rad (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Dp430, by Tiangen Biotech (1 mentions)
15 protocols using dp431
1
Drosophila Transcriptome Analysis by qRT-PCR
2
Gene Expression Analysis in Lung Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from lung tissue using an animal tissue RNA extraction kit (DP431, Tiangen Biotech Co. Ltd.). The extracted RNAs were reverse transcribed into cDNAs by using a FastQuant RT kit with gDNase (KR106, Tiangen Biotech Co. Ltd.). The purity and quality of the RNA were examined with an UV spectrophotometer at 260 and 280 nm. To assess the expression of target genes, quantitative real-time PCR was performed using SuperReal Color PreMix (FP216, Tiangen Biotech Co. Ltd.) according to the manufacturer's instruction. Sequences of the mouse gene-specific primers used were listed as follows: β1-actin: forward, AGACAGGGGCCTTTTTGCTAC, reverse, AATTCGCCGGAGACACTCG; Bax: forward, AACAGGGGCTTTACGTTCACT, reverse, CGTCCCTTTATAGCTGCCTCC; Bcl-2: forward, AGCCCTGTGCCACCATGTGTC, reverse, GGCAGGTTTGTCGACCTCACT; HGF: forward, AACAGGGGCTTTACGTTCACT, reverse, CGTCCCTTTATAGCTGCCTCC; MMP-9: forward, GGACCCGAAGCGGACATTG, reverse, CGTCGTCGAAATGGGCATCT. The relative expression of the target gene was analyzed using the comparative 2−∆∆CT method.
By subtracting the Ct value of β-actin from that of the target gene, we obtained △Ct, whereas △△Ct was calculated by subtracting the value of △Ct from that of the sham control sample.
By subtracting the Ct value of β-actin from that of the target gene, we obtained △Ct, whereas △△Ct was calculated by subtracting the value of △Ct from that of the sham control sample.
3
Quantitative RT-PCR analysis of virus-challenged brain tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA in brain tissues of virus challenged and mock-infected mice were extracted with total RNA extraction kit for animal tissues (DP431, Tiangen Biotech Co., LTD, Beijing, China) according to the manufacturer's protocol. The concentrations of the extracted RNA were measured using a spectrophotometer (260/280 nm). Subsequently, 1 μg RNA of each sample was transcribed by HiScript® II Q RT SuperMix for qPCR (+gDNA wiper) (Vazyme, Nanjing, China) to obtain the cDNA. With reference to the gene sequences of the proteins identified by mass spectrometry, the specific primers (Table S1 ) for simultaneous detection of different target genes were designed using PrimerQuest Tool of the Integrated DNA Technologies (https://sg.idtdna.com/site/account/login?returnurl=%2FPrimerquest%2FHome%2FIndex ). The RT-PCR was performed by using the 7,500 Real-Time System (Applied Biosystems) with ChamQ SYBR Color qPCR Master Mix (Vazyme, Nanjing, China). The quantitative analysis of data using the obtained standard curve was performed in the 7,500 System SDS software Version 1.4.1 following the relative quantification (ΔΔCt) model (Applied Biosystems). The mock-infected mice brains were used as internal controls.
4
Quantitative RT-PCR Analysis of ICH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After obtaining brain tissue from mice at different ICH time points (n=6), total RNA was extracted using a total RNA extraction kit (DP431, TIANGEN), and the concentration and purity were determined using a NanoVue Plus Micro-Volume UV-Vis spectrophotometer. The total RNA was then reverse transcribed into cDNA using a reverse transcription kit (FSQ-201, TOYOBO), and the concentration and purity of the cDNA were determined. Finally, 20μL of amplification reaction mix (QPS-201, TOYOBO) was prepared and the samples were introduced into an ABI StepOne Real-Time PCR system. The primer sequences are listed in Table 2 . The ΔΔCT method was used to calculate the results. The data obtained were analyzed by one-way ANOVA. Tukey multiple comparison was used to test for statistical significance between groups.
5
Quantifying Gene Expression in Wound Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time quantitative PCR (RT-qPCR) was performed to assess the influence of IL-10-ADMSC on gene expression in wound tissues [25 (link)]. In brief, we used a total RNA extraction kit (DP431, Tian Gen, China) to extract total RNA from tissues and prepared cDNA using a reverse transcription kit (A3500, Promega, USA). As stated in manufacturing instructions of a GoTaq qPCR mix kit (A6006A, Promega, USA), we prepared 200 μL RT-qPCR reaction system and detected the gene expression using a RT-qPCR instrument (CFX384, BIO-RAD, USA). The relative expression of gene was calculated by 2−ΔΔCt method. β-Actin was loaded as control for mRNA, and U6 was loaded as control for miRNA. Primers was showed as follow: MCP-1-F:5′-GCATCAACCTGACCCCTCAA-3′, MCP-1-F:5′-ATCACACACGCATCTGAGCA-3′; MIP-1β-F:5′-TGCTCGCTTCTCCGAACAAT-3′, MIP-1β-R:5′-CCCTTCCATGCGGTTAGGTT-3′; IL-1β-F:5′-CGCATGTTCCTGGGGAGATT-3′, IL-1β-R:5′-ATCTTTTGGGGTCCGTCAACT-3′; IL-6-F:5′-CCTGAACCTTCCAAAGATGGC-3′, IL-6-R:5′-TTCACCAGGCAAGTCTCCTCA-3′.
6
Real-Time PCR Analysis of Muscle Metabolism Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frozen leg and breast muscle tissues were homogenized in liquid nitrogen, and total RNA was extracted using the RNA extraction kit (Tiangen DP431), according to the manufacturer's instructions, and was reverse-transcribed to cDNA. The primers for AMPD1, PGM1, PKM2, GAPDH, and β-actin were designed using Primer Premier 5.0 software based on the published sequences of chicken AMPD1 (accession number XM_003642728), PGM1 (accession number NM_001038693.2), PKM2 (accession number: XM_015278795.2), GAPDH (accession number NM_204305.1), and β-actin (accession number: NM_205518.1). The sequences are summarized in Table 1 . The SYBR Green Pro Taq HS kit was used for qRT-PCR reactions, and the relative gene expression levels were calculated using the 2−△△Ct method.Table 1
Primers information of real-timePCR.
| Gene | Accession | Primer sequence information |
|---|---|---|
| AMPD1 | XM_003642728 | F:TACCCAGGATTTATGATGT |
| R:CTTGAGGATTGACAGTTG | ||
| PGM1 | NM_001038693.2 | F:ATCACTGGCAGAAGTATGG |
| R:CAAAGGAGCGGTCAA | ||
| PKM2 | XM_015278795.2 | F:GTGTTCGCTTCCTTCATC |
| R:ATTCTCAATCTTGCTGATAATCT | ||
| GAPDH | NM_204305.1 | F:CTGTCAAGGCTGAGAACG |
| R:GATAACACGCTTAGCACCA | ||
| ACTIN | NM_205518.1 | F:TGCGTGACATCAAGGAGAAG |
| R:GGACTCCATACCCAAGAAAGAT |
7
Quantitative Real-Time PCR Analysis of TGF-β Pathway
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from tissues and cells using total RNA extraction kit (DP431, Tiangen Biotech (Beijing) Co. Ltd., China), and cDNA was synthesized using the PrimeScript™ RT Reagent Kit (Perfect Real Time) (TAKARA Bio Inc., Shiga, Japan). The target genes were amplified by PCR using the following conditions: pre-denaturation at 95 °C for 2 min, followed by 40 cycles of denaturation at 95 °C for 10 s, annealing and extension at 60 °C for 10 s. Three replicates were performed in each group. The primers were listed in Table 1 .
Primer information
| Gene name | Primer name | Sequence (5′ → 3′) |
|---|---|---|
| TGF-β1 | TGF-β1-F | AACACAGCAGAGTGGTTGTC |
| TGF-β1-R | TGTCCAGGCTCCAGATGTA | |
| TGF-βR1 | TGF-βR1-F | GATTTGGAGAAGTTTGGCG |
| TGF-βR1-R | TCCCAGAATACTAAGCCCAT | |
| Smad2 | Smad2-F | CAGGAAGAGAAGTGGTGTGA |
| Smad2-R | ATACTGGAGGCAGAACTGGT | |
| CK19 | rabbit-CK19-F | GCGAACAGCCACTACTTCA |
| rabbit-CK19-R | GTCTCAAACTTGGTTCGGA | |
| VIM | rabbit-VIM-F | CGTTGACAATGCTTCTTTGG |
| rabbit-VIM-R | TGGATTTCCTCATCGTGC | |
| FSP-1 | rabbit-FSP1-F | GGGAAAGAGGGTGACAAGTT |
| rabbit-FSP1-R | GTCCAAGTTGCTCATCAGC | |
| E-cadherin | rabbit-Ecadherin-F | ACCCAGGTCTTCTACAGCAT |
| rabbit-Ecadherin-R | GATGTGTTCTCGGTCCAGA | |
| GAPDH | GAPDH-F | CTTTGGTATCGTGGAAGGA |
| GAPDH-R | AGGGATGATGTTCTGGAGAG |
8
Total RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the samples using TRIzol Reagent (Invitrogen, Carlsbad CA, USA), and a pure tissue kit (Tiangen, DP431) was used to isolate the RNA. A 10 μM reverse transcription reaction was performed using 1000 ng of total RNA. The random primer reverse transcription method was used with the ScriptTM RT Master Mix kit, according to manufactures’ instructions, to generate cDNA synthesis for each sample.
9
Hepatic Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Guided by the manufacturer’s instructions, hepatic cDNAs of IRS2/phosphatidylinositol-3-kinases catalytic subunit alpha (PIK3CA)/AKT were synthesized (Kits from TIANGEN, DP431, Beijing, China). Realtime PCR was performed with the Applied Biosystems (Thermo Scientific™, ABI7500, Waltham, MA, USA) using the SYBR® Premix ExTaqTM II (Takara, RR820A, Dalian, China). The sequences of primers (synthesized by Shenggong Bioengineering, Shanghai, China) are shown in Table 2 and their effectiveness were verified by the BLAST function test on PubMed. The mRNA expression was normalized against the corresponding control gene β-actin. Relative quantitative method was used to calculate the expression levels of the three genes, and the relative multiple change of the target gene = 2−ΔΔCT:
10
Quantitative Analysis of Lipid Metabolism Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression levels of key genes in the lipid metabolizing pathway were measured using real-time quantitative PCR (RT-qPCR). RNA extraction, reverse transcription and RT-qPCR were the same as our previous study [7 (link)]. In brief, total RNA from the liver sample was isolated using a commercial kit (Tiangen, DP431, Beijing, China). Reverse transcription was performed immediately following the total RNA isolation using a first strand cDNA synthesis kit (Takara, 6110A Dalian, China). RT-qPCR was performed using the CFX96TM Real-Time System (Bio-Rad, CA). The expression level of target mRNA was normalized to the mRNA level of beta-actin. The linear amount of the target gene expression to the internal standard was calculated by 2-△△CT. The gene sequences involved in the present study were obtained from GenBank (www.ncbi.nlm.nih.gov/Genbank ), and the accession numbers and sequences of the primers used are listed in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!