L3000015

For the knockdown of SP1 and YY1, we transfected 50 nM siRNAs against SP1 (si-SP1), YY1 (si-YY1) by lipofectamine 3000 (L3000015, ThermoFisher Scientific, Shanghai, China) in MDA-MB-231 and MDA-MB-468 cells (Table S1). SiRNAs that could not target them were the negative controls (si-NC).
For overexpression of SP1, the pcDNA3.1 (vector) functioned as an empty vector to conduct the overexpressed plasmid (ov-SP1), and MDA-MB-231 and MDA-MB-468 cells were transfected with 2 μg ov-SP1 plasmid by lipofectamine 3000.
For the knockdown of AFAP1-AS1, 2 μg sh-NC and sh-AFAP1-AS1 were transfected by lipofectamine 3000.

3T3-L1 preadipocytes were transfected with DNAJC6 using a chemical method (L3000015, Thermo Fisher, Waltham, MA, USA). To increase the transfection efficiency, serum-free DMEM was used. A DNA master mix was prepared by mixing Opti-MEM, 2500 ng DNAJC6 DNA (OriGene, Rockville, MD, USA), P3000 reagent, and lipofectamine 3000 reagent. After reacting at room temperature for 15 min, the DNA master mix was dispensed into cells and cultured for 3–4 h. To remove untransfected cells during the transfection process, cells was cultured in DMEM containing 500 μg/mL of G418 (Cat #10131035, Thermo Fisher, Waltham, MA, USA) for 20 h under the same conditions described above. Thereafter, Tg^Hsp cells were cultured using the same process and conditions of differentiation as those of the control group (Days 0–8).

HUVECs were transfected with 3.75 μl PCAF/YAP or negative control siRNA using Lipo3000 after cell confluence reached 70–80% according to the manufactures' protocols. When cell confluence was 90%, 2.5 ng plasmid and corresponding control plasmid along with 3.75 μl Lipo3000 and p3000 (L3000-015, Thermo Fisher) were cocultured with HUVECs in opti-MEMI medium (Gibco,31985070) for 6 hours then refreshed with ECM. Cell lysates were collected after 48 h infection.
siRNA was purchased from Gene Pharma (Shanghai, China) siRNA targeting
PCAF#1: AGAGCAGUCCUGGAUUA,
PCAF#2: UCGCCGUGAAGAAAGCGCATT,
PCAF#3: GGCUACGUCCAGGAGCGCACC,
YAP#1: GACAUCUUCUGGUCAGAGA,
YAP#2: CUGGUCAGAGAUACUUCUU.

The recombinant PKM2 plasmid was constructed by ligating the full-length open reading frame (cDNA) of PKM2 and cloning it into an expression vector pcDNA3.1 (HanhengBio, Shanghai, China). The expression plasmids were transiently transfected into cultured NRK-49F cells with 60–80% of confluence using lipofectamine 3000 (L3000015, Thermo Fisher Scientific, Massachusetts, United States), in accordance with the manufacturer’s instructions. The transfected cells were cultured with MC-RR treatment for 48 h and harvested for the PKM2 rescue assay.

Constructs for the iRhom2-knockout plasmid and the empty vector (EV) plasmid were used in a plasmid extraction kit (OMEGA, D2156-00, Guangzhou, China) and were measured at concentrations >90%. All constructs were confirmed with DNA sequencing. The plasmids were transfected into L02 cells using lipofectamine 3000 (Thermo Fisher, L3000015) according to the manufacturer’s instructions, incubated at 37 °C in a humidified atmosphere containing 5% CO₂ for 24 h, and successful transfection was observed under a fluorescent microscope (Supplementary Figure S2).

DH5α competent bacteria (18258012, Thermo Fisher Scientific) were transformed by heat shock and CEPIA3mt/pCMV construct (58219, Addgene) was added^{27 (link)}. Samples were incubated for 14 h at 37 °C in LB agar (22700025, Thermo Fisher Scientific), supplemented with 100 μg/μl of ampicillin (11593027, Gibco). Colonies were selected and transferred to supplemented media for further incubation during 14 h for bacterial growth. Plasmid DNA was purified by NucleoBond XtraMidi (740410.10, Macherey-Nagel) kit and purity and DNA concentration were determined by spectrophotometry (absorption at 260/280 nm). For the transfection, 10⁵ Jurkat cells were starved in Optimem reduced media over 12 h, collected, exposed to complexes of lipofectamine 3000 (L3000015, Thermo Fisher Scientific) and plasmidic DNA (1 µg), and centrifuged (400 × g) for 30 min to promote interaction. Cells were incubated at 37 °C with 5% CO₂ overnight, whereas FBS (10%) was added at the next day. Protein expression was monitored, and experiments were performed 24 h after transfection. For confocal imaging, cells were placed in home-made coverslips-bottomed chambers. Images were acquired using a confocal microscope (LSM 700, Carl Zeiss) equipped with ×40/×63 oil-immersion objectives.