The bacterial density of AKM and LGG in the fecal samples was estimated using quantitative real-time polymerase-chain reaction (qPCR) with species specific primers (AKM_Fwd: 5’-CCT TGC GGT TGG CTT CAG AT-3’ and AKM_Rev: 5’-CAG CAC GTG AAG GTG GGG AC-3’85 (link) and LGG_Fwd: 5’-GCC GAT CGT TGA CGT TAG TTG G-3’ and LGG_Rev: 5’-CAG CGG TTA TGC GAT GCG AAT-3’86 (link)) purchased from Integrated DNA Technologies. Standard curves (Table S2) were based on a dilution series of total DNA extracted from monocultures of AKM and LGG. The qPCR results were obtained using the CFX96 Touch Real-Time PCR Detections System (Bio-Rad Laboratories) and the reagent SsoFast EvaGreen Supermix with Low ROX (Bio-Rad Laboratories, cat. No. 1725211), and run as previously described87 (link).
Cfx96 touch real time pcr detections system
Manufactured by Bio-Rad
Sourced in United States
The CFX96 Touch Real-Time PCR Detection System is a real-time PCR instrument designed for accurate and precise gene expression analysis. It features a 96-well format and utilizes fluorescence detection technology to monitor and quantify DNA amplification in real-time.
Automatically generated - may contain errors
2 protocols using cfx96 touch real time pcr detections system
1
Quantitative Analysis of Gut Microbiome
2
Validating RNA Sequencing and siRNA Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Validation of RNA sequencing data and knockdown efficiency of the siRNA transfection was determined by RT‐qPCR. Total RNA was extracted using the miRNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. cDNA was transcribed with the LunaScript RT SuperMix Kit (New England BioLabs, Ipswich, MA, USA) and qPCR performed with the Luna Universal qPCR Master Mix (New England BioLabs) and the CFX96 Touch Real‐Time PCR Detections System (Bio‐Rad Laboratories, Hercules, CA, USA). Human primer sequences (5′–3′, Sigma‐Aldrich) were used to measure KLRK1‐AS1 expression (forward TGAAACGGATTCCCATGGCT, reverse TGCTTCTTTCTCTGATCTGTGTCT) normalised to RPLP0 (forward TCGACAATGGCAGCATCTAC, reverse ATCCGTCTCCACAGACAAGG) to obtain ΔCt values. Samples were analysed in triplicate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!