Sybr premix ex taqtm reagent

Total RNA was prepared using SV total RNA isolation system (Promega, Madison, WI, USA) referring to the manufacturer’s protocols. The quantity and quality of RNA extracts were analyzed by the Agilent 2100 Bioanalyzer (Agilent Technologies, Waldbronn, Germany). Complementary DNA (cDNA) was synthesized using the Maxima H Minus First Strand cDNA synthesis kit (Thermo Fisher Scientific) with random hexamer primers for ATXN8OS and VASP mRNA and TaqMan MicroRNA reverse transcription kit (Applied Biosystems, Bleiswijk, The Netherlands) with target-specific stem-loop primers for miR-16-5p, referring to the instructions of manufacturers. The expression levels of ATXN8OS, VASP mRNA, and miR-16-5p were determined by quantitative real-time polymerase chain reaction (qRT-PCR) using SYBR^® Premix Ex Taq^TM reagent (Takara, Dalian, China), with β-actin or U6 snRNA as the internal control. Primers sequences (5′–3′) for qRT-PCR were as follows: ATXN8OS: CATTACTGTGTAGCAATAC (sense) and AATTCAAGCCATTAACCT (antisense); VASP: CTGGGAGAAGAACAGCACAACC (sense) and AGGTCCGAGTATCACTGGAGC (antisense); β-actin: GATGGAAATCGTCAGAGGCT (sense) and TGGCACTTAGTTGGAAATGC (antisense); miR-16-5p: CGCGCTAGCAGCACGTAAAT (sense) and GTGCAGGGTCCGAGGT (antisense); U6: GCTTCGGCAGCACATATACTAAAAT (sense) and CGCTTCACGAATTTGCGTGTCAT (antisense).

Total RNA was extracted from 50 to 100 porcine oocytes without zona pellucida and reverse transcribed into cDNA by the SuperScript TM IV Cells Direct TM cDNA Kit (Invitrogen, USA). RNA was extracted from various tissues of adult pigs by Trizol lysis buffer and reverse transcribed to cDNA using TransScript All-in-One-First-Strand cDNA (TranGen Biotech, Beijing, China). Primers used for qPCR were listed in Table 2. qPCR was performed using SYBR® Premix Ex Taq TM Reagent (TaKaRa). qPCR was a 20 μl reaction: 10 μl SYBR green premix, 2 μl primers, 2 μl cDNA, and 6 μl RNase-free water. The qPCR amplification conditions used a two-step method.

Total RNA was isolated using the same protocol as above. Equal amounts of RNA were reverse-transcribed into cDNA using the ReverTra Ace-a-First strand cDNA synthesis kit (M-MLV Reverse Transcriptase, Promega Corporation, Madison, WI, USA), as instructed by the manufacturer. Quantitative real-time PCR was performed using the Roche LightCycler 480 II System (DRR041A; Takara Bio, Inc., Otsu, Shiga, Japan) with SYBR Premix Ex Taq^TM reagent (DRR041A; Takara Bio, Inc.). The quantity of each mRNA was normalized to that of GAPDH mRNA, and relative abundance was calculated using the 2^-ΔΔCT method.

RNA was extracted from treated pancreatic cancer cells using TRIzol reagent (Ambion, Life Technologies). cDNA was generated using a reverse transcription kit (Takara, China) in a 96-well thermal cycler (Applied Biosystems). Quantitative PCR was conducted using SYBR Premix Ex TaqTM-Reagent (TakaRa, China) by applying StepOnePlus™ (Applied Biosystems) based on the manufacturer’s instructions. The IFIT1 forward primer used was TGAGCCTCCTTGGGTTCGTCTAC, and the IFIT1 reverse primer used was CTCAAAGTCAGCAGCCAGTCTCAG. β-actin forward: CTCCATCCTGGCCTCGCT GT; β-actin reverse: GCTGTCACCTTCACCGTTCC. Fold changes in expression relative to β-actin were calculated using the 2–DDCt method.

Total RNA was isolated from podocytes (3×10⁶ cells/well) in accordance
with the instructions for TRIzol reagent (Invitrogen). Extracted RNA samples
(miR-770-5p and E2F3) were reversed into complementary DNA (cDNA) using M-MLV
reverse transcriptase (Promega, USA). The cDNA amplification of miR-770-5p and
E2F3 was implemented with SYBR^® PremixExTaq^TM reagent
(TaKaRa) on ABI Prism^® 7500 Sequence Detection System (Applied
Biosystems, USA). The relative expression levels of miR-770-5p and E2F3 were
calculated by the 2^-ΔΔCt method. U6 small nuclear RNA (snRNA) and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were used as internal
references to normalize miR-770-5p orE2F3 expression, respectively. The
following primer sequences were used in RT-qPCR:miR-770-5p (ABI miRNA specific
primers, ABI#002002); E2F3: 5′-TATCCCTAAACCCGCTTCC-3′ (sense), 5′-TTCACAAACGGTCCTTCTA-3′ (antisense);
U6: 5′-GCTTCGGCAGCACATATACTAAAAT-3′ (sense), 5′-CGCTTCACGAATTTGCGTGTCAT-3′(antisense); GAPDH: 5′-AGAAGGCTGGGGCTCATTTG-3′ (sense), 5′-AGGGGCCATCCACAGTCTTC-3′(antisense).

RNA was extracted from treated pancreatic cancer cells using TRIzol reagent (Ambion, Life Technologies). cDNA was generated using a reverse transcription kit (Takara, China) in a 96-well thermal cycler (Applied Biosystems). Quantitative PCR was conducted using SYBR Premix Ex TaqTM-Reagent (TakaRa, China) by applying StepOnePlus™ (Applied Biosystems) based on the manufacturer’s instructions. The IFIT1 forward primer used was TGAGCCTCCTTGGGTTCGTCTAC, and the IFIT1 reverse primer used was CTCAAAGTCAGCAGCCAGTCTCAG. β-actin forward: CTCCATCCTGGCCTCGCT GT; β-actin reverse: GCTGTCACCTTCACCGTTCC. Fold changes in expression relative to β-actin were calculated using the 2–DDCt method.