The largest database of trusted experimental protocols

5 protocols using mir 96 5p mimic

1

Regulation of Colonic Cell Lines by miRNA and Protein Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
The HT‐29 and Caco‐2 colonic cell lines were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). MiR‐124‐3p mimics, miR‐96‐5p mimics, miR‐124‐3p inhibitors and miR‐96‐5p inhibitors were purchased from GenePharma (Shanghai, China), and the sequences are shown in Table S1. Knockdown or overexpression lentivirus vectors (Lv‐shRab27A, Lv‐shSTAT3, Lv‐Rab27A and Lv‐STAT3) were purchased from GenePharma (Shanghai, China). The cells were distributed in 6‐well plates to approximately 50%‐70% confluence and were transfected the next day with plasmid at a concentration of 100 nmol\L in DMEM (GenePharma, Shanghai, China) using Lipofectamine 3000 (Invitrogen, USA), according to the manufacturer's instructions.
+ Open protocol
+ Expand
2

Modulating CDK1 Expression in CNE-2Z Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Briefly, CNE-2Z cells were plated and grown to 80–90% confluence, each well was added with 2 mL medium without antibiotics. CDK1 overexpression vector (pc-CDK1), miR-96-5p mimics or NC mimics were synthesized by GenePharma (Shanghai, China). According to the manufacturer’s instructions, CNE-2Z cells were transfected using Lipofectamine 2000 (Invitrogen, CA, USA) and were harvested 24 h after transfection for the following experiments.
+ Open protocol
+ Expand
3

Plasmid Construction and Transfection for GMDS-AS1 Study

Check if the same lab product or an alternative is used in the 5 most similar protocols
The overexpression plasmids pcDNA‐GMDS‐AS1 and lentiviral overexpression plasmid Lenti‐GMDS‐AS1 were constructed by Sangon Company. Luciferase reporter plasmids include wild type and mutant pGLO‐GMDS‐AS1, as well as wild type and mutant pGLO‐CYLD 3'UTR, both constructed by Sangon Company. The mimic and inhibitor of miR‐96‐5p and CYLD siRNA were obtained from Genepharma Company; the sequence of miR‐96‐5p mimic was UUUGGCACUAGCACAUUUUUGCU, and the sequence of inhibitor was AGCAAAUUAGTCGUGTGCCAAA with the sequence of negative control of miR‐96‐5p was UUCUCCGAACGUGUCACGUUU. The plasmids or siRNAs were transfected using the Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc). Cell transfection was performed as described previously.21
+ Open protocol
+ Expand
4

Hypoxia-Reoxygenation Injury Model

Check if the same lab product or an alternative is used in the 5 most similar protocols
The AC16 cell lines (ventricular cardiomyocyte of humans) were obtained from the American Type Tissue Culture Collection. The cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM; Solarbio, China) containing 10% fetal bovine serum (Gibco, United States), 0.1 mg/ml streptomycin (Solarbio, China), and 100 units/ml penicillin (Solarbio, China) at a condition of 37°C with 5% CO2. The cell injury model was established by hypoxia and reoxygenation (H/R). The cells without H/R served as control. The cells were cultured in a medium without glucose and fetal bovine serum for 6 h at a hypoxia condition of 5% CO2 and 0.1% O2 and then were reoxygenated in DMEM containing normal glucose and 10% fetal bovine serum for 12 h. The circPostn shRNA, control shRNA, miR-96-5p mimic, control mimic, miR-96-5p inhibitor, control inhibitor, and the pcDNA3.1-BNIP3 overexpression vector were obtained (GenePharma, China). The transfection in the cells was performed by Liposome 3000 (Invitrogen, United States) according to the manufacturer’s instructions.
+ Open protocol
+ Expand
5

Establishing Myocardial Infarction in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
To establish the MI mouse model, the C57BL/6 mice (4–6 months old, male, 25–30 g) were intraperitoneally injected with ketamine (120 mg/kg) and xylazine (5 mg/kg body weight) for anesthetization. The left anterior descending coronary artery occlusion/reperfusion (LAD/reperfusion) was performed. Briefly, we placed the LAD on the heart surface by applying an anatomy microscope and ligated the LAD for 30 min, followed by the restoration of blood flow. Sham mice were conducted the surgery without occlusion of LAD. We injected the lentiviral vectors comprising shRNA of circPostn (Genechem, China) (1 × 107 TU/mice) or the lentivirus comprising control shRNA in the mice ventricular cavity, followed by the construction of the MI mouse model. Then, the heart tissues and blood were collected from mice for further analysis. The cardiac injury was assessed by hematoxylin and eosin (H&E) staining. The cardiac function was analyzed by echocardiography measurement with an ultrasound system (Panoview, China) furnished with a 30-MHz phased-array transducer in 3-day post-MI mice. The circPostn shRNA, control shRNA, miR-96-5p mimic, control mimic, miR-96-5p inhibitor, control inhibitor, and the pcDNA3.1-BNIP3 overexpression vector were obtained (GenePharma, China). Animal care and method procedure were authorized by the Animal Ethics Committee of PLA General Hospital.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!