Psuper retro puro plasmid

Human GSK3β (BC000251), GDI2 (BC005145), Rabin8 (BC059358), and mouse Dzip1 (BC098211) were each cloned from the cDNA libraries of the human B cell and mouse embryo brain (E14). Mutagenesis was conducted using standard molecular approaches. The DNA fragments for expressing the short hairpin RNAs that target the base pair positions 1308–1327 and 2172–2191 of the mouse Dzip1 gene were generated by annealing the following pairs of oligonucleotides (only sense sequences are shown): 5′-GATCCCCCTGAAAGGGACTCCTTTAATTCAAGAGATTAAAGGAGTCCCTTTCAGTTTTTA-3′ and 5′-GATCCCCCTGACAGGAACCTCCATTATTCAAGAGATAATGGAGGTTCCTGTCAGTTTTTA-3′, and the annealed oligonucleotides were then ligated into the pSuper-RetroPuro plasmid (OligoEngine). Transfection of these plasmids using Megatrans (Origene) was performed according to the manufacturer’s instructions.

The full-length human GRB7 was subcloned into the pMSCV-retro-puro vector (Clontech, Palo Alto, CA). The forward PCR primer was 5'-AGATCTATGGAGCTGGATCTGTCTCCAC-3' and reverse PCR primer was 5'-GAATTCTCATCAGAGGGCCACCCGC-3'. Besides, under the help of RNA interference (RNAi) method, the GRB7 knock down bladder cancer cell lines was also established. To endogenously downregulate GRB7, two hairpin GRB7 siRNA oligonucleotides (sense, 5'-GATCCCGCGAGTCCAACGTGTACGTGTTCAAGAGACACGTACACGTTGGACTCGTTTTTTGGAAA-3'; antisense, 5'-AGCTTTTCCAAAAAACGAGTCCAACGTGTACGTGTCTCTTGAACACGTACACGTTGGACTCGCGG-3') were inserted into the subcloned pSUPER.retro.puro plasmid (Oligoengine, Seattle, WA). As described before, retroviral production and infection were performed 19 (link).

Using the NeonTM transfection system (Invitrogen), nodose-dissociated primary cultures were transfected with one of the following DNAs: pEGFPC1, Sytx1AH3TMEGFP, shRNA TI-VAMP D06 (5′CCGGGCACTTCCTTATGCTATGAATCTCGAGATTCATAGCATAAGGAAGTGCTTTTTG3′, MISSION iRNA, Sigma) (TI-VAMP shRNAD06) and shRNA TI-VAMP D07 (5′CCGGCTTACTCACATGGCAATTATTCTCGAGAATAATTGCCATGTGAGTAAGTTTTTG3′, MISSION iRNA, Sigma) (TI-VAMP shRNAD07). For Sytx1 RNAi experiments, we used a pSUPER.retro.puro plasmid (OligoEngine, Seattle, WA, USA) and specific oligonucleotides of the Sytx1A sequence: 5′GATCCCCCCAAGAAGGCCGTCAAGTATTCAAGAGATACTTGACGGCCTTCTTGGTTTTT3′ (Forward), and 5′AGCTAAAAACCAAGAAGGCCGTCAAGTATCTCTTGAATACTTGACGGCCTTCTTGGGGG3′ (Reverse) [17 (link)] (Sytx1AshRNA1) and a shRNA Sytx-1 (5′CCGGGAAAGCCATCGAGCAAGGAATCTCGAGATTCCTTGCTCGATGGCTTTCTTTTTG3′), MISSION iRNA, Sigma) (Sytx1AshRNA2).
The cells and explants were washed twice with PBS 0.1M and then electroporated with two pulses of 1200V for 20 sec, followed by three pulses of 500V for 30 sec. The explants were then plated in collagen, while the primary culture was plated in polyornithine-laminin pre-coated coverslips at a cell density of 5,000, both in DMEM plus medium supplemented with 0.54% glucose, 0.032% NaH2CO3, L-glutamine, B27, N2 and BDNF (50 ng/ml, Promega).