According to the manufacturer’s protocol, total RNA was isolated from murine plasma and HT-22 cells using TRIzol (Invitrogen, Carlsbad, CA, USA). The RNA was then reverse transcribed with a stem-loop RT primer (RiboBio, Guangzhou, China) using HiScript Q Select RT SuperMix for the qPCR kit (Vazyme, Piscataway, NJ, USA) and quantified using AceQ qPCR SYBR Green master mix (Vazyme, Piscataway, NJ, USA). The levels of miR-125b-5p mRNA were determined via qRT-PCR and were normalized to the level of Gapdh. For mature miRNAs, the RNA was reverse transcribed with a stem-loop RT primer (RiboBio, USA) using HiScript Q Select RT SuperMix for the qPCR kit (Vazyme, Piscataway, NJ, USA). The cDNA was then set up in a qPCR reaction using AceQ qPCR SYBR Green master mix (Vazyme, Piscataway, NJ, USA). Each procedure was performed in triplicate. The primers used to amplify the circRNAs, and mRNA transcripts, were synthesized by Invitrogen (Carlsbad, CA, USA). The sequences of the primers are listed in Table S1 .
Stem loop rt primer
Manufactured by RiboBio
Sourced in China, United States, Japan
Stem-loop RT primers are a type of reverse transcription (RT) primers used in the detection and quantification of microRNA (miRNA) expression. These primers are designed with a stem-loop structure that allows for specific binding and reverse transcription of mature miRNA molecules. The stem-loop structure enhances the specificity and sensitivity of the RT reaction, enabling accurate and reliable miRNA expression analysis.
Automatically generated - may contain errors
Lab products found in correlation
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (6 mentions)
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Trizol reagent, by Takara Bio (2 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Revertaid h minus first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Gapdh, by RiboBio (1 mentions)
Rt pcr primers, by RiboBio (1 mentions)
Sybr primescript rt pcr kit, by Takara Bio (1 mentions)
Hiscript q select rt supermix for the qpcr kit, by Vazyme (1 mentions)
Aceq qpcr sybr green master mix, by Vazyme (1 mentions)
Abi 7500 detection system, by Thermo Fisher Scientific (1 mentions)
Cfx96 real time pcr system, by Bio-Rad (1 mentions)
Mirna primer, by RiboBio (1 mentions)
Sybr green realtime pcr master mix, by Toyobo (1 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
Sybr premix ex taq tli rnaseh plus, by Takara Bio (1 mentions)
Sybr green qpcr master mixes, by Takara Bio (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
16 protocols using stem loop rt primer
1
Quantification of miR-125b-5p Expression
2
RNA Extraction and Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA, including miRNA, was extracted using RNAiso Reagentreagent (Takara, Japan) according to the manufacturer's instruction. GABBR1 mRNA level was tested using SYBR PrimeScript RT‐PCR Kit (Takara) with the following primers: GABBR1 forward primer, 5′‐GAGGACGTGAATAGCCGCAG‐3′ and GABBR1 reverse primer, 5′‐CTGGATCACACTTGCTGTCGT‐3′. GAPDH forward primer, 5′‐CTGGGCTACACTGAGCACC‐3′, reverse primer: 5′‐AAGTGGTCGTTGAGGGCAATG‐3′. For miRNA analysis, the stem‐loop RT primer and the RT‐PCR primers for each individual miRNAs were purchased from Ribobio (Guangzhou, China). The relative expression of each individual miRNAs was normalized to that of the internal control U6.
3
Quantifying microRNA expression using RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RT was performed using a PrimeScript RT Reagent kit (Takara Biotechnology Co., Ltd., Dalian, China). Stem-loop RT primers and PCR primers for each miRNA were purchased from Ribobio Co., Ltd. (cat. nos. U6 MQP-0202, rno-mir-125b-2-3p miRQ0004731-1-1, rno-mir-187-5p miRQ0017144-1-1, rno-mir-3542 miRQ0017796-1-1, rno-mir-92a-2-5p miRQ0017108-1-1 and rno-mir-99a-5p miRQ0000820-1-1). Fluorescence qPCR was performed on an ABI 7500 detection system (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Each 20 μl reaction mixture contained 2 μl template cDNA, 0.4 μM of each gene-specific primer, 10 μl SYBR Premix Ex Taq II (Tli RNaseH Plus, 2X), 0.4 μl ROX Reference Dye II (50X), and 6 μl sterilized Rnase-free water. The reactions were incubated at 50°C for 2 min, 95°C for 2 min, followed by 40 cycles of 95°C for 15 sec, and 60°C for 60 sec. The reactions were incubated at 50°C for 2 min, 95°C for 2 min, followed by 40 cycles of 95°C for 15 sec, and 60°C for 60 sec. With stable expression in the normal and ARM groups, U6 was selected as an endogenous reference gene for qPCR normalization purposes and the relative expression level of each miRNA was calculated using the 2−ΔΔCq method (17 (link)). RT-qPCR analysis was performed with three replicates.
4
Total RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA in mice thymus, thymocytes and TECS were extracted with Trizol reagent (Takara, Kusatsu, Japan). First-strand cDNA was synthesized with a ReverTra Ace quantitative real time-PCR (qRT-PCR) RT Kit (Toyobo, Osaka, Japan), with random hexamers (for mRNAs and lncRNAs) and stem-loop RT primers (for miRNAs, purchased from RiboBio) according to the manufacturer’s instructions. Primers of mRNAs and lncRNAs (Table S1 ) were designed by Primer Premier 5.0 software (Premier Biosoft International, USA), and miRNA primers were purchased from RiboBio (Guangzhou, China). β-actin (for mRNAs and lncRNAs) and U6 (for miRNAs) were used to normalize the data. qRT-PCR was performed by a Bio-Rad CFX96 Real-Time PCR system (Bio-Rad, Hercules, CA, USA) using SYBR Green Real-Time PCR Master Mix (Toyobo) following the manufacturer’s instructions. All qRT-PCR assays were conducted in triplicate, and the relative levels were measured in terms of threshold cycle (Ct) and calculated using the formula 2−∆∆Ct [41 (link)].
5
Quantifying miR-30c Expression in Nerve Stumps
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA isolated from proximal nerve stumps was reverse transcribed using a TaqMan® MicroRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) and stem-loop RT primers (Ribobio) to detect the expression levels of miR-30c. For quantification of gene expression, real-time PCR was conducted using SYBR Premix Ex Taq (Tli RNaseH Plus) (TaKaRa) and a StepOnePlus real-time PCR system (Applied Biosystems). The relative expression levels were quantified by the 2-ΔΔCt method.
6
Quantifying miRNA and mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol reagent (Invitrogen, USA). cDNA was synthesized by Revert Aid First Strand cDNA Synthesis Kit (Thermo Scientific, USA). The RT reaction for miR-150 was carried out with stem-loop RT primers (RiboBio, China). Quantitative PCR was performed using SYBR Green qPCR Master Mixes (Takara, China). Relative expression was determined using U6 (primers from RiboBio, China) as the internal control for miRNAs and GAPDH as the internal control for mRNAs of other genes (primers listed in Table 1 and Supplementary Table S1 ).
7
Quantifying miR-129 and IGF-1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from tissues and cells using Trizol reagent (Invitrogen), and cDNA was prepared from total RNA using a Prime-Script RT reagent Kit (TaKaRa, Dalian, China) according to the manufacturer’s instructions. qRT-PCR was performed with SYBR Premix Ex Taq (TaKaRa) on an ABI system (Applied Biosystems, Foster City, CA) according to standard protocols. The relative expression of miR-129 was quantified with stem-loop RT primers (Ribobio) according to manufacturer’s instructions and normalized against the U6 level. The sequences of IGF-1 primers are as follows: GACCAAGGGGCTTTTAC, TCAGATCACAGCTCCGG. All reactions were run three independent times in triplicate. The relative expression was calculated using the comparative 2−ΔΔCt method.
8
Detecting miRNA and mRNA expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For miRNA or mRNA content detection, total RNA was extracted from cells or tissues using Trizol (Invitrogen, USA) according to the manufacturer’s instructions. cDNA was synthesized via RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA). The reverse transcription reaction for miR-150 was carried out with stem-loop RT primers (RiboBio, China). QRT–PCR was performed using a SYBR Green Master Mix (Bio-Rad, USA). Relative expression was determined using U6 snRNA (primers from RiboBio, China) as an internal control for miR-150 and GAPDH as an internal control for FOXO4. The primers used are listed in Supplementary Table 1 .
9
Quantifying miR-454-3p expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using the RNeasy kit (QIAGEN, United States). cDNA was synthesized using the RevertAid H Minus First-Strand cDNA Synthesis Kit (Thermo Scientific, United States). Stem-loop RT primers (RiboBio, China) were used in reverse transcription for miR-454-3p. qPCR was performed using the One-Step qRT-PCR SYBR® Green Kit (Vazyme Biotech, China). The sequences of primers targeting 4.1N/EPB41L1 and miR-454-3p were used as described earlier (Wang et al., 2010 (link)) and designed by Vazyme Biotech (Nanjing, China). U6 small nuclear RNA was used as an internal control for miR-454-3p analysis.
10
Stem-Loop RT-qPCR for miRNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Since stem-loop RT primers show better efficiency and specificity compared to conventional primers (14 (link)), the RT reaction was conducted using a RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific) and stem-loop RT primers (Guangzhou RiboBio Co., Ltd., Guangzhou, China). Fermentas® RNase-free DNase I (Thermo Fisher Scientific) was used to remove genomic DNA from the RNA samples. qPCR was performed with the FastStart Universal SYBR-Green Master mix (Roche Applied Science, Indianapolis, IN, USA) on a Corbett Rotor-Gene 3000 system (Qiagen, Valencia, CA, USA). Following amplification, melting-curve analysis was performed as described by the manufacturer. Each RNA sample was analyzed in triplicate, and all measurements contained a negative control with no cDNA template and an endogenous control with an rno-U6 small nuclear RNA (snRNA). The relative expression levels of the miRNAs were calculated with the comparative cycle threshold (Ct) method using the REST 2009 software (Qiagen) (15 (link)).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!