Plko 1 trc cloning vector

To generate pLKO.1-Slc7a11shRNA plasmid, forward oligonucleotide (5′-CCGGGCCCTGTCCTATGCAGAATTACTCGAGTAATTCTGCATAGGACAGGGCTTTTTG-3′) was annealed with reverse oligonucleotide (5′-AATTCAAAAAGCCCTGTCCTATGCAGAATTACTCGAGTAATTCTGCATAGGACAGGGC-3′), and then subcloned into an AgeI (#R0552S, NEB, USA)/EcoRI (#R0101S, NEB, USA) digested pLKO.1-TRC cloning vector (#10879, Addgene, USA). To produce pLKO.1 Lentiviral particles, 293FT cells were co-transfected in a 4:3:1 ratio with pLKO.1-shRNA (or pLKO.1-Slc7a11shRNA), psPAX2, and pMD2.G. The supernatant containing the viral particles was collected 48 and 72 h post-transfection. B16F10 cells were infected with the virus supernatant for 48 h, followed by an additional 7-day selection with 500 μg/mL G418 (#10131035, Invitrogen, USA). Subsequently, C57BL/6 N mice were randomly inoculated with either 5 × 10⁵ WT or Slc7a11-KD B16F10 cells, and tumor volumes were measured since the 10th day post-inoculation. For CD8 depletion assay, 200 μg CD8 antibody was intraperitoneally injected into each mouse three days before tumor inoculation and on days 1, 7, and 12 post-inoculation (Supplementary Fig. 3j).

The lentivirus-mediated transfection method was used to generate stable TCF7L1 knockdown gastric cancer cell lines. Next, the pLKO.1-TRC cloning vector obtained from Addgene (Watertown, USA) was used to express shRNA oligoes against TCF7L1 [16 (link)]. The two 21-bp shRNAs targeting against TCF7L1 were 5′-ATCCGAGCTGTCACCGTATTA-3′ and 5′-TCCAGCACACTTGTCTAATAA-3′, respectively. Scramble shRNA or Scr (Addgene plasmid 1864; Addgene, Watertown, USA) was used as negative controls. Lentiviral particles were produced by co-transfecting TCF7L1 silencing constructs with psPAX2 and pMD2.G vectors in a ratio of 4:3:1 into HEK293T cells. Stable TCF7L1 knockdown cell lines were obtained by infecting AGS and MGC-803 cells with lentiviral particles and subsequent puromycin selection.

The pLKO.1 - TRC cloning vector was obtained from Addgene (Cambridge, MA, USA). shRNA target sequences are as follows: shCBP-1: GCGGAGCCATCTAGTGCATA; ShCBP-2: GCAAGACATCCCGAGTCTATA; shLuc (Ctrl): CTTACGCTGAGTACTTCGA. The experiment was conducted according to the Addgene's protocol. The positive clones were verified by sequencing.

For NEAT1 knockdown using CRISPR/dCas9-KRAB, guide RNAs were cloned into lentiGuide-Puro (Addgene #52963). For YBX1 knockdown using shRNA, shRNAs were cloned into the pLKO.1-TRC cloning vector (Addgene #10878). For overexpression of YBX1, the coding sequence of YBX1 was cloned into pLVX-DsRed-Monomer-N1 (Takara, Kyoto, Japan). The sequences of sgRNAs and primers are listed in Table S1. Stable NEAT1 and YBX1 knockdown and overexpression of YBX1 HepG2 cells were generated using lentiviral plasmids. In brief, to knock down NEAT1, 293FT cells were transfected with pCMV-dR8.2 dvpr, pCMV-VSV-G, lentiGuide-Puro, and dCas9-KRAB (Addgene #110820). To knock down YBX1, 293FT cells were transfected with pCMV-dR8.2 dvpr, pCMV-VSV-G, and pLKO.1-shRNAs. Viral supernatants were harvested, and then HepG2 cells were infected with viral particles. These HepG2 cells were then selected to generate stable clones with puromycin (2 μg/mL).

shRNA sequences for each gene target were obtained from The RNAi Consortium (TRC) library database and sequences with high adjusted scores (2 shRNA sequences per gene) were selected for synthesis (Table S2). Oligonucleotides (both sense and antisense) carrying Age1/EcoR1 sticky ends, hairpin loop sequence and shRNA sequence were synthesised (IDT technologies, Coraville, IA, USA) and annealed oligos cloned into pLKO.1 TRC cloning vector (Addgene #10878) using the unique Age1/EcoR1 sites.
A pool of two shRNA plasmids per gene was then packaged into lentiviral particles using psPAX2 and pMD2.G, as previously described [9 (link)]. Alternatively, and where indicated, shRNA plasmids (pool of three shRNA plasmids per target) were obtained directly from Santa Cruz.

To generate shRNA expression constructs against ARF6 and DUSP6, pLKO.1 TRC cloning vector (Addgene plamid: 10878; Addgene, Cambridge, USA) was employed
[23] (link). Targets (21 bp) against ARF6 were as follows: sense, 5′-GCTCACATGGTTAACCTCTAA-3′ and antisense, 5′-AGCTGCACCGCATTATCAATG-3′. Targets (21 bp) against DUSP6 were as follows: sense, 5′-CTGTGGTGTCTTGGTACATTG-3′ and antisense, 5′-TCTAATCCAAAGGGTATATTT-3′. Overexpression constructs of DUSP6 were obtained by using the pCDH-CMV-MCS-EF1-Puro vector, and empty vector (EV) was used as the control. Lentiviral particles of ARF6 were produce by co-transfection of pLKO.1-shARF6 constructs with psPAX2 and pMD2.G into HEK-293T cells in a ratio of 4:3:1. It is the same when it comes to the DUSP6. Cell lines were obtained by infection of PANC-1 and SW1990 cells with lentiviral particles, followed by puromycin selection.