The ovarian cancer cell line SKOV3 was obtained from American Type Culture Collection (Manassas, VA, USA) and maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS). The cells were incubated at 37°C in an atmosphere containing 5% CO2. Human miR-101 mimics hsa-miR-101 and hsa-miR-Ctrl were obtained from Dharmacon (Chicago, IL, USA). Small-interfering RNA (siRNA) targeting ZEB1 or ZEB2 and scrambled negative siRNA control were purchased from Sigma (St. Louis, MO, USA).
Small interfering rna sirna
Manufactured by Merck Group
Sourced in United States
Small-interfering RNA (siRNA) is a type of laboratory equipment used for gene silencing. It functions by targeting and degrading specific mRNA molecules, thereby reducing the expression of corresponding genes.
Automatically generated - may contain errors
Lab products found in correlation
Skov3, by American Type Culture Collection (2 mentions)
Scrambled negative sirna control, by Merck Group (2 mentions)
Lipofectamine rnaimax, by Thermo Fisher Scientific (1 mentions)
Rpmi 1640, by Thermo Fisher Scientific (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
Hepg2, by American Type Culture Collection (1 mentions)
Hepg2, by Thermo Fisher Scientific (1 mentions)
H1299 cells, by Thermo Fisher Scientific (1 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
Opti mem medium, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (1 mentions)
A2780, by American Type Culture Collection (1 mentions)
Mir ctrl, by Horizon Discovery (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Heya8, by American Type Culture Collection (1 mentions)
4 protocols using small interfering rna sirna
1
Ovarian Cancer Cell Culture and miRNA Manipulation
2
Cell Culture and siRNA Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
H1299 and HepG2 cells were purchased from the American Type Culture Collection. H1299 cells were cultured in RPMI‐1640 (Gibco) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. HepG2 cells were cultured in DMEM (Gibco) supplemented with 10% FBS and 1% penicillin/streptomycin. All cells were cultured at 37°C with 5% CO2. Small‐interfering RNA (siRNA) was manufactured by Sigma‐Aldrich. The sequences are listed in Table S1 . Lipofectamine RNAiMAX (Thermo Fisher Scientific) was used for transfection of siRNA. Total RNA was extracted at 48 h after treatment for reverse‐transcription quantitative PCR (RT‐qPCR). RNA extraction was performed with an RNeasy Plus Mini kit (Qiagen) according to the manufacturer's instructions.
3
siRNA Knockdown of Human ZEB1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small-interfering RNA (siRNA) targeting human ZEB1 was purchased from Sigma Aldrich (St Louis, MO, USA). The ZEB1 siRNA sequences were as follows: CCAAUAAGCAAACGAUUCUGA, antisense: AGAAUCGUUUGCUUAUUGGCA. We used MISSION siRNA Universal Negative Control (Sigma Aldrich) as a control. Cells were seeded in 10cm dishes overnight to reach 30-40% confluence. Then they were transfected with 600 pmol of siRNA using Lipofectamine 2000 reagent (Invitrogen) in OPTI-MEM medium (GIBCO). Six hours later, the transfected cells were transferred to complete medium. After 48 h, the cells were harvested and used for RT-PCR and Q-RT-PCR.
4
Ovarian and Cervical Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ovarian cancer cell lines SKOV3, HeyA8 and A2780, and the cervical cancer cell line HeLa were obtained from the American Type Culture Collection and maintained in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) without any antibiotics. The cells were incubated at 37°C in an atmosphere containing 5% CO2. Human miR-508-3p mimic (hsa-miR-508-3p) and scrambled negative control (miR-ctrl) were obtained from GE Healthcare Dharmacon, Inc. Small interfering RNA (siRNA) targeting CCNA2 or MMP7 and scrambled negative siRNA control were purchased from Sigma-Aldrich; Merck KGaA. The pcDNA3.1 plasmids (Promega Corporation) expressing CCNA2 or MMP7 and empty vectors (EV) were constructed by Shanghai GenePharma Co., Ltd.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!