Genamp pcr system 9700

The DNA (deoxyribonucleic acid) from all samples was genotyped for single nucleotide polymorphisms (SNPs). First, conventional PCR was used to amplify a fragment of Pfmdr 1, Pfcrt, Pfdhfr, Pfdhps, and Pfmrp 1 genes on an Applied Biosystems’ GenAmp PCR system 9700 (Foster City, CA, USA). The primary reaction was done as earlier described [38 (link)]. The SNPs were then determined by amplification of a fragment of the respective gene as earlier described [38 (link)] using real-time PCR machine Applied Biosystems’ prism 7500 Fast real-time PCR system (Foster City, CA, USA).

The bacterial genomic DNA of selected isolates was subjected to amplification using Gen Amp PCR System 9700 (Applied Biosystems) in a 20 μL volume. The primers used for pqqA gene were forward primer pqqA-F: 5ʹATGTGGACCAAACCTGCATAC3ʹ and reverse primer pqqA-R:5ʹGCGGTTAGCGAAGTACATGGT3ʹ, while the primer set for pqqC gene were forward primer pqqC-F:5ʹATTACCCTGCAGCACTACAC3ʹ and reverse primer pqqC-R:5ʹ CCAGAGGATATCCAGCTTGAAC 3ʹ. The composition of reagents was:10X Assay Buffer (1×), MgCl₂ (0.5 mM), dNTPs (200 µM), Taq polymerase (1U), Forward and reverse primer (0.3 μM), Template DNA (50 ng). For the amplification of 2 PQQ genes the reaction conditions were as follows: Initial denaturation 94 °C for 5 min (1 cycle); denaturation 94 °C for 30 s (30 cycles); annealing 50 °C for 30 s; extension 72 °C for 1 min; and final extension 72 °C for 10 min (1 cycle). The presence of amplified fragments was checked on 2.0% (^w/_v) Agarose gel with 50 bp DNA ladder³⁷ .

The target sequence of the L1-LCR-E6 region genome of about 1700 bp HPV-16 was amplified by using g16f-7122, g16f-7122, g16r-7714, g16f-7663, g16r-376, g16f-273, and g16r-913 primers on GenAmp PCR System 9700 (Applied Biosystems, Foster City, CA, USA) (29 (link),30 (link)), and sequenced by using 3500 Dx Genetic Analyzer (Applied Biosystems). The presence of the amplicon was analyzed by gel electrophoresis (0.8% agarose). Nucleotide sequences were analyzed with the Vector NTI program (Thermo Fisher Scientific, Waltham, MA, USA). Nucleotide HPV-16 sequences (E6, E7, and long control region [LCR]) from patients and reference nucleotide sequences were aligned by using MAFFT, v. 6.846 software algorithm (31 (link)). A maximum likelihood phylogenetic tree was constructed with the RAxML HPC2, v. 7.6.3 algorithm (32 (link)), based on the evolutionary GTRCAT model and with the bootstrap value of 1000.

Pseudomonas specific primers forward primer Ps-for (5′ GGTCTGAGAGGATGATCAGT 3′) and the reverse primer, Ps-rev (5′ TTAGCTCCACCTCGCGGC 3′) were used to amplify a 990-bp region of 16S rRNA gene (Widmer et al. 1998 (link)). Genomic DNA of 51 presumptive Pseudomonas isolates was used on thermal cycler, Gen Amp PCR System 9700 (Applied Biosystems). A 50 µl of reaction mixture included, 5 µl (5–10 ng) of bacterial DNA as template, 5 µl of 10X buffer for Taq DNA Polymerase (100 mM of TRIS–HCl and 15 mM MgCl₂), 2.5 µM of each primer, 250 µM of dNTPs, and one unit of Taq DNA polymerase (Bangalore Genei, India). The reaction condition includes an initial denaturation of 5 min at 95 °C, followed by 35 cycles of 1 min at 94 °C, 1 min at 57 °C and 1 min at 72 °C with the final extension of 10 min at 720 °C. Amplified DNA was visualized after electrophoresis using UV gel documentation system GelDocMega (Biosystematica).

For extraction of genomic DNA, young leaves (1 g) of 172 tomato cultivars, wild species, and F1 hybrids were collected and genomic DNA was isolated by CTAB method [49 (link)]. PCR was performed in a total volume of 10 µL containing 2 µL of genomic DNA, 0.5 µL of forward and 0.5 µL of reverse primers (10 pmol), 5 µL of Prime Taq Premix and 2 µL of distilled water. The reaction condition was as follows: samples were primarily denatured at 95 °C for 5 min; followed by 30 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 30 s and final elongation at 72 °C for 5 min in a GenAmp PCR system 9700 (Applied Biosystems, Seoul, Korea). The amplicon was run on a 1.2% agarose gel. PCR conditions for Ty2 and cf9 were: initial denaturation at 95 °C for 5 min followed by denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, elongation at 72 °C for 30 min repeated for up to 30 cycles and final elongation at 72 °C for 5 min. Finally, the reaction mixture was cooled down to 4 °C and the amplicon was loaded on 1.2% agarose gel concentration.

Multiplex RT-PCR for sweet potato potyviruses was performed as described by Li
et al. (2012 (link)) with minor
modifications. Total RNA with reverse primer SPFCG2-R (Table 1) was denatured at 65 °C for 10 min and cDNA
synthesized using 5× RT buffer, 0.1 M DTT, 10 mM dNTPs, RNAse
Out inhibitor 40 U μL ⁻¹ and M-MLV 200 U
μL⁻¹, and the reaction was incubated at 40 °C for 60
min, 95 °C for 5 min. Reaction mix for PCR was prepared using 5× Dream Taq
buffer (Invitrogen), 25 mM MgCl₂,10 mM dNTPs (Invitrogen),
primers SPG-F (2.5 μL), SPC-F (0.4 μL), SPF-F (2 μL), SP2-F (0.2
μL) and SPFCGG2-R (2 μL), each at a concentration of 10
μM, Dream Taq 5 U μL ⁻¹ and cDNA. The mixture
was incubated in a thermal cycler machine (GenAmp PCR system 9700; Applied Biosystems)
using the following conditions: 94 °C for 2 min, 94 °C for 30 s; then 35
cycles of 60 °C for 30 s, 72 °C for 1 min 20 s, 72 °C for 10 min.
The gel was prepared using 1.2% agarose in 1× TAE buffer and ethidium
bromide was used for staining. This was run at 200 V for 30 min and the product viewed
and recorded using a gel documentation machine.