Data assist software version 3

Ct values were analyzed using RQ Manager version 1.2.2. (Applied Biosystems). Automatic threshold was set and subsequently adjusted by using manual threshold where needed. One assay (Rfpl4b) did not pass our quality criteria and was thus excluded from further analysis. ΔCt values were obtained using DataAssist Software version 3.0 (Applied Biosystems). The endogenous controls Hprt1 and Psmb6 were used for normalization. Nanog and Nlrp5 were used as positive controls for “Up” and “Down” clusters, respectively. The Ct value 40.0 was included in the calculations for not detected transcripts. The lowest calculated −ΔCt value in the samples in the same protocol was set for all the not detected transcripts in this protocol. −ΔCt values for undetected samples were not included in the calculation of average values for plotting, unless all replicas were undetected. Changes in the expression between MII vs 1-cell, 1-cell vs 2-cell, and 2-cell vs 8-cell were calculated using student's t-test when at least two replicas were detected in both stages. p-values equal to or less than 0.05 were considered significant (Table S1). heatmap.2 function from gplots package in R was used for drawing heatmaps.

For qPCR detection, the total RNA from different samples was extracted using TRIzol reagent according to the manufacturer’s instructions. GAPDH served as a reference gene. The cDNA templates for integrins β1 and β3 were created by reverse transcription of RNA using a RT-PCR kit (Fermentas; Waltham, MA, USA). The 20 μL reaction mixture consisted of 10 μL of SYS BR Primix Ex Taq 2 solution, 0.5 μL of each primer (integrin β1, forward primer: ATGTGTCAGACCTGCCTTGG, reverse primer: GGGACACAGGATCAGGTTGG; integrin β3, forward primer: GGCAAGTGTGAATGTGGCAG, reverse primer: GACTCAATCTCGTCACGGCA; GAPDH forward primer: 5′-TATGATGATATCAAGAGGGTAGT, reverse primer, 5′-TGTATCCAAACTCATTGTCATAC-3′), 1 μL of the cDNA template, and 8 μL of RNase-free H₂O. The amplification conditions were as follows: a denaturation step performed at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s, 60 °C for 1 min, and 72 °C for 30 s. The relative integrin β1 and β3 expression levels were calculated using Data Assist Software version 3.0 (Applied Biosystems/Life Technologies; Carlsbad, CA, USA) and the 2^−∆∆ct method.

Human tissue specimens were ground into a powder using liquid nitrogen. Tissue RNA was extracted with TRIzol reagent (TransGen Biotech, Beijing, China), and then, miR-506 and UHRF1 mRNA expression levels were analyzed by quantitative real-time PCR (qRT-PCR). The qRT-PCR assay was performed as follows: RNA was detected using a reverse transcription kit (TaKaRa, Dalian, China) and an amplification kit (TaKaRa) following the manufacturer’s instructions. U6 was used as the internal control for miR-506 expression levels, and GAPDH was used as the internal control for the UHRF1 gene. The reaction mixture contained 10 μl of SYBR Premix Ex Taq 2, 1 μl of each primer, 2 μl of the cDNA template, and 6 μl of ddH₂O for a final volume of 20 μl. The thermal cycling parameters for amplification were as follows: a denaturation step at 95°C for 30 s, followed by 40 cycles at 95°C for 5 s and a final holding step at 60°C for 34 s. Relative gene expression was evaluated with Data Assist software version 3.0 (Applied Biosystems, Foster City, CA, United States). The relative expression levels were determined according to the 2^–ΔΔCT method. The assays were performed in triplicate. Primer sequences for each gene were shown in Table 1.

Tumor and matched adjacent normal liver tissues which were obtained from five HCC patients in the current study, were frozen immediately after surgery, and were stored at −135 °C for RNA extraction. Frozen sections were made and evaluated independently by senior pathologists. The study was approved by the First Affiliated Hospital of PLA General Hospital ethnics committee. The ethics committee approved the relating screening, inspection, and data collection of the patients, and all subjects signed a written informed consent form. All works were undertaken following the provisions of the Declaration of Helsinki.
The whole RNA of liver tissue for each sample was extracted using RNAeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacture’s protocol. Ten genes were randomly selected from the 20 most significantly DEGs. Primers for the ten genes were designed using PrimerPlex 2.61 (PREMIER Biosoft, Palo Alto, CA) (Additional file 1: Table S1). Expression levels of genes were screened by SYBR (Applied Biosystems/Life Technologies, Carlsbad, CA) in ABI 7500 Real Time PCR System (Applied Biosystems, Carlsbad CA). Relative gene expression was calculated with Data Assist Software version 3.0 (Applied Biosystems/Life Technologies) and human actin gene was used as a reference. The expression level of each gene was determined according to the method of 2^-△△ct.