ChIP analysis was performed using a PierceTM Agarose ChIP Kit (Thermo Scientific, Rockford, IL). Sheared chromatin was diluted and immunoprecipitated with 2 μg of anti-STAT3, anti-TCF4 or control IgG antibody. DNA protein complexes were eluted from protein A/G agarose beads using a spin column and were reverse cross-linked by incubating with NaCl at 65 °C. The relative TCF4 binding to the c-MYC and uPAR promoters or STAT3 binding to miR-21 promoter was analyzed by MyiQ™ Single-Color Real-Time PCR Detection System (Bio-Rad, Hercules, CA) with SYBR Green PCR master mix using following primer sequences, STAT3 binding to miR-21 promoter/enhancer (F) CCTCTGAGAAGAGGGGACAA and (R) ACCGCTTCCAGCAAAAGAGT. General PCR amplification also performed in a Mastercycler thermal cycler (Eppendorf, Foster City, CA).
Piercetm agarose chip kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Pierce Agarose ChIP Kit is a laboratory product designed for chromatin immunoprecipitation (ChIP) experiments. It contains pre-made agarose beads that are used to capture and isolate specific DNA-protein complexes from cell or tissue samples.
Automatically generated - may contain errors
Lab products found in correlation
Mastercycler thermal cycler, by Eppendorf (4 mentions)
Myiq single color real time pcr detection system, by Bio-Rad (2 mentions)
7500 fast real time pcr detection system, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions)
Chip seq library prep master mix set, by Illumina (2 mentions)
Hiseq 2500 sequencing platform, by Illumina (2 mentions)
Ab272456, by Abcam (1 mentions)
Normal rabbit igg, by Thermo Fisher Scientific (1 mentions)
Anti klf5, by Santa Cruz Biotechnology (1 mentions)
Formaldehyde, by Thermo Fisher Scientific (1 mentions)
Transam nf kb family kit, by Active Motif (1 mentions)
Tb green premix ex taq, by Takara Bio (1 mentions)
Anti stat3 antibody, by Santa Cruz Biotechnology (1 mentions)
Sc 2025, by Santa Cruz Biotechnology (1 mentions)
19 protocols using piercetm agarose chip kit
1
ChIP Analysis of Transcription Factor Binding
2
ChIP Assay of Nrf2 and Bach1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CHIP assay was performed using a PierceTM Agarose CHIP Kit (Thermo Scientific, Rockford, IL, USA). Briefly, L02 cells were treated with or without Hyp (200 μM) for 24 h. DNA and proteins were cross-linked by incubating cells with 1% formaldehyde for 10 min at room temperature. Excess formaldehyde was quenched with glycine for five minutes. Cells were then lysed and nuclei were digested using micrococcal nuclease. Sheared chromatin was diluted and immunoprecipitated with 10 μg of anti-Nrf2, anti-Bach1 or control IgG antibody. DNA-protein complexes were eluted from the protein A/G agarose beads using a spin column and were reverse cross-linked by incubating with NaCl at 65°C.
3
Chromatin Immunoprecipitation and Quantitative PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP analysis was performed using a PierceTM Agarose ChIP Kit (Thermo Scientific, Rockford, IL). Sheared chromatin was diluted and immunoprecipitated with 2 μg of anti-STAT3, anti-TCF4 or control IgG antibody. DNA protein complexes were eluted from the protein A/G agarose beads using a spin column and were reverse cross-linked by incubating with NaCl at 65°C. The relative TCF4 binding to the c-MYC and uPAR promoters or STAT3 binding to miR-21 promoter was analyzed by MyiQ™ Single-Color Real-Time PCR Detection System (Bio-Rad, Hercules, CA) with SYBR Green PCR master mix using following primer sequences, TCF4 binding to c-Myc promoter: (F) GCGCCCATTAATACCCTTCT and (R) TCTCCCTTTCTCTGCTGCTC; TCF4 binding to uPAR promoter: (F) GGAAGCAAAGCAAGGGTTAAG and (R) GCCCTGACTCATGGAGTTGT; STAT3 binding to miR-21 promoter/enhancer (F) CCTCTGAGAAG AGGGGACAA and (R) ACCGCTTCCAGCA AAAGAGT. General PCR amplification also performed in a Mastercycler® thermal cycler (Eppendorf, Foster City, CA).
4
RUNX1 Binding to LRRC15 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The ability of RUNX1 to enrich the LRRC15 promoter was assayed using a PierceTM Agarose ChIP kit (Thermo Fisher Scientific). Briefly, RA-FLS were cross-linked with 1% paraformaldehyde at room temperature for 10 min, then 0.125 M glycine was added to arrest the crosslinking reaction. The cells were centrifuged, lysed with a buffer containing Protease Inhibitor Cocktail, and centrifuged again to obtain nuclei. An ultrasonic disruptor was set to 4 s per ultrasonic cycle at 8-s intervals for 6 min. After addition of elution buffer containing RNase A, the samples were incubated with Proteinase K for 2 h at 62°C. Fragmented chromatin extracts were incubated with ChIP Grade RUNX1 antibody (1:50, ab272456; Abcam) or normal rabbit IgG (Thermo Fisher Scientific) overnight at 4°C, and with protein A/G magnetic beads for 2 h at 4°C. After thorough washing, elution, and de-crosslinking, purified DNA was used for qPCR analysis. PCR primer sequences for the LRRC15 promoter were as follows: forward primer: 5′-TGCCTACTTACCAGCAGCTC-3′, reverse primer: 5′-GCCAGCTATGTGTACCCTGT-3′.
5
ChIP-qPCR Analysis of VEGF Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP analysis was performed using a Pierce TMA garose ChIP Kit (Thermo Scientific, Rockford, IL). Sheared chromatin was diluted and immunoprecipitated with 2 μg of anti-FoxM1 or control IgG antibody. DNA protein complexes were eluted from protein A/G agarose beads using a spin column and were reverse cross-linked by incubating with NaCl at 65°C. The intensity of FoxM1 binding to the VEGF promoter was analyzed by Applied Biosystems® 7500 Fast Real-Time PCR Detection System with SYBR Green PCR master mix using following primer sequences, FoxM1 binding to the VEGF promoter sites, F1 (−1,635 to −1,420 bp): (F) GGAGCGTTTTGGTTAAATTGAG and (R) TGCATATAGGAAGCAGCTTGGA; F2 (−634 to −442 bp): (F) CCCCTTTCCAAAGCCCATTCC and (R) CCTTCTCCCCGCTCCAACACCC. General PCR amplification also performed in a Mastercycler® thermal cycler (Eppendorf, Foster City, CA).
6
KLF5 ChIP-qPCR Assay for BACE1 Regulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A chromatin immunoprecipitation (ChIP) assay was performed using a PierceTM agarose ChIP kit (Thermo Fisher Scientific) in accordance with the manufacturer’s protocol. SH-SY5Y cells and hippocampal tissues of 2-, 5-, and 8-month-old APP/PS1 mice were prepared for the assay. Briefly, the SH-SY5Y cells were treated with PMA (100 nM) for 2 h to induce KLF5, and hippocampal tissues (100–120 mg) were homogenized with a mortar and pestle for single-cell suspension preparation. Then, the cells were cross-linked in 10 ml of 1% formaldehyde (Thermo Fisher), and DNA was fragmented to 200–1000 bp in length through enzyme digestion. Each 150 μl of chromatin solution was immunoprecipitated using 10 μg of monoclonal anti-KLF5 (Santa Cruz, CA, USA) or IgG control overnight at 4°C. Input and immunoprecipitated samples were digested with proteinase K to reverse the cross-linking at 65°C for 90 min. DNA was purified and further analyzed through qPCR by using the primers against the BACE1 promoter (Supplementary Table S2 ).
7
Chromatin Immunoprecipitation (ChIP) Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A ChIP assay was carried out according to the instructions for the PierceTM Agarose ChIP kit (Cat. #26156, Thermo Scientific). (For more details, see Supplementary Methods.)
8
Chromatin Immunoprecipitation of Nrf2
9
Quantifying KLF5 Binding to HIF1-α Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP analysis was performed using a Pierce TMA garose ChIP Kit (Thermo Scientific, Rockford, IL, USA). Sheared chromatin was diluted and immunoprecipitated with 2 μg of anti-KLF5 or control IgG antibody. DNA protein complexes were eluted from protein A/G agarose beads using a spin column and were reverse cross-linked by incubating with NaCl at 65 °C. The intensity of KLF5 binding to the HIF1-α promoter was analyzed by Applied Biosystems® 7500 Fast Real-Time PCR Detection System with SYBR Green PCR master mix using following primer sequences, KLF5 binding to the HIF1-α promoter sites, S1 (GGGTG, −481 to −486): (F) CTTTCCTCCGCCGCTAAAC and (R) GGGTTCCTCGAGATCCAATG, S2 (CACCC, −602 to −607): (F) GATGCATGTTTGGGACCAG and (R) CTCACGTGCTCGTCTGTGTT, S3 (GGGTG, −931 to −936): (F) AAACTCCGCCACAGAAAAAC and (R) CAAGCCCTTCCTTTGGTCTC, S4 (CACCC, −1552 to −1557):(F) AGGCTTCTCCAGCCTCACAC and (R) TATAGAAGCATCAAACTCTGACAAGA. General PCR amplification also performed in a Mastercycler® thermal cycler (Eppendorf, Foster City, CA).
10
RelB-Mediated Transcriptional Regulation of SOD2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nuclear extracts were prepared and RelB-DNA binding activities measured using an ELISA-based TransAM NF-kB Family kit (Active Motif) [9 (link)]. A PierceTM Agarose ChIP Kit (Thermo Fisher) was used to study RelB-mediated transcriptional regulation. Chromatin that was pulled down using a RelB antibody and a DNA fragment containing an NF-kB element located on the I2E promoter/enhancer region of the human SOD2 gene was analyzed by quantitative PCR. PCR primer sequences were 5′-cggggttatgaaatttgttgagta-3′ (upper strand) and 5′-ccacaagtaaaggactgaaattaa-3′ (lower strand). MnSOD exon 2 was amplified as an untargeted control. Primer sequences were 5′-tgaccgggctgtgctttctcg-3′ (upper strand) and 5′-actgcctcccgccgctcagcc-3′ (lower strand). ChIP-qPCR data were normalized by input preparation.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!