Log In Sign up
The largest database of trusted experimental protocols

N myc tagged pmxs puro retroviral vector

Manufactured by Cell Biolabs
Visit Supplier

The N-MYC-tagged pMXs-Puro Retroviral Vector is a plasmid-based vector used for the expression of proteins in mammalian cell lines. The vector contains the N-MYC tag sequence, allowing for the detection and purification of the expressed proteins. Additionally, the vector includes a puromycin resistance gene, enabling the selection of successfully transduced cells.

Automatically generated - may contain errors

Lab products found in correlation

Platinum e retroviral packaging cells, by Cell Biolabs (2 mentions) Anti qki, by Fortis Life Sciences (2 mentions) Anti myb antibody, by Abcam (2 mentions) Anti myc hrp, by Thermo Fisher Scientific (2 mentions) Anti myc antibody, by Thermo Fisher Scientific (1 mentions) Anti craf antibody, by Cell Signaling Technology (1 mentions) Anti flag antibody, by Merck Group (1 mentions) N terminal myc or flag tag, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

N-MYC-tagged pMX-Puro Retroviral Vector PMXs-puro retroviral vector Retroviral pMX vector PMXs-puro vector PMXs-puro

3 protocols using n myc tagged pmxs puro retroviral vector

1

Generation and Characterization of RAF1 Fusion Constructs

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
SRGAP3-RAF1 and QKI-RAF1 constructs were synthesized as Gateway compatible entry clones. Full-length RAF1, QKI and SRGAP3 were purchased as gateway entry clones from PlasmID/Dana-Farber/Harvard Cancer Center DNA Resource Core. Sub-cloning was done to integrate SRGAP3-RAF1, QKI-RAF1, full-length QKI, RAF1 and SRGAP3 into Gateway-compatible N-MYC-tagged pMXs-Puro Retroviral Vector (Cell Biolabs). NIH3T3 and early-passage PMAs were transduced using infection protocol previously described18 (link). Gateway destination vectors with either an N-terminal MYC or FLAG tag (Invitrogen) were generated for all constructs. Anti-MYC antibody (Invitrogen R951-25, 1:5000) and anti-FLAG antibody (Sigma A8592, 1:10,000) were used to detect tagged-proteins along with anti-CRAF antibody (Cell Signaling #9422).
QKI-RAF1 dimerization mutants were generated by PCR-based site-directed mutagenesis of MYC- and FLAG-tagged constructs. RAFR401H dimerization mutants35 (link), 36 (link) in QKI-RAF1 were generated using primers: Forward CGCAAAACACACCATGTGAACA and Reverse CAGAACAGCCACCTCATTCCT. QKIE48G dimerization mutants31 (link) in QKI-RAF1 were generated using primers: Forward CTGGACGAAGGAATTAGCAGAG and Reverse CAGCCGCTCGAGGTGGTT.
Jain P., Fierst T.M., Han H.J., Smith T.E., Vakil A., Storm P.B., Resnick A.C, & Waanders A.J. (2017). CRAF gene fusions in pediatric low-grade gliomas define a distinct drug response based on dimerization profiles. Oncogene, 36(45), 6348-6358.
+ Open protocol
+ Expand
2

Retroviral Expression of MYB-QKI Fusion Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
MYB-QKI5 and MYB-QKI6 constructs were synthesized as Gateway compatible entry clones. MYBtr constructs were generated via PCR mutagenesis using MYB-QKI fusions as templates. Full-length MYB and QKI constructs were purchased as gateway entry clones from PlasmID/DF/HCC DNA Resource Core. MYB-QKI5 and MYB-QKI6, MYBtr, full-length MYB and QKI constructs were sub-cloned into a Gateway-compatible N-MYC-tagged pMXs-Puro Retroviral Vector (Cell Biolabs). Platinum-E retroviral packaging cells (Cell BioLabs) were used to generate retrovirus as per manufacturer protocols. NIH3T3 cells were infected with retrovirus containing media for 6 hours and puromycin selection commenced 48 hours post infection. Stable expression of MYC-tagged proteins was confirmed via western blot analysis (anti-MYC HRP 1:5000 (Invitrogen), anti-MYB antibody 1:5000 (Abcam) and anti-QKI 1:1000 (Bethyl Lab).
Bandopadhayay P., Ramkissoon L.A., Jain P., Bergthold G., Wala J., Zeid R., Schumacher S.E., Urbanski L., O’Rourke R., Gibson W.J., Pelton K., Ramkissoon S.H., Han H.J., Zhu Y., Choudhari N., Silva A., Boucher K., Henn R.E., Kang Y.J., Knoff D., Paolella B.R., Gladden-Young A., Varlet P., Pages M., Horowitz P.M., Federation A., Malkin H., Tracy A., Seepo S., Ducar M., Hummelen P.V., Santi M., Buccoliero A.M., Scagnet M., Bowers D.C., Giannini C., Puget S., Hawkins C., Tabori U., Klekner A., Bognar L., Burger P.C., Eberhart C., Rodriguez F.J., Hill D.A., Mueller S., Haas-Kogan D.A., Phillips J.J., Santagata S., Stiles C.D., Bradner J.E., Jabado N., Goren A., Grill J., Ligon A.H., Goumnerova L., Waanders A.J., Storm P.B., Kieran M.W., Ligon K.L., Beroukhim R, & Resnick A.C. (2016). MYB-QKI rearrangements in Angiocentric Glioma drive tumorigenicity through a tripartite mechanism. Nature genetics, 48(3), 273-282.
+ Open protocol
+ Expand
3

Retroviral Expression of MYB-QKI Fusion Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
MYB-QKI5 and MYB-QKI6 constructs were synthesized as Gateway compatible entry clones. MYBtr constructs were generated via PCR mutagenesis using MYB-QKI fusions as templates. Full-length MYB and QKI constructs were purchased as gateway entry clones from PlasmID/DF/HCC DNA Resource Core. MYB-QKI5 and MYB-QKI6, MYBtr, full-length MYB and QKI constructs were sub-cloned into a Gateway-compatible N-MYC-tagged pMXs-Puro Retroviral Vector (Cell Biolabs). Platinum-E retroviral packaging cells (Cell BioLabs) were used to generate retrovirus as per manufacturer protocols. NIH3T3 cells were infected with retrovirus containing media for 6 hours and puromycin selection commenced 48 hours post infection. Stable expression of MYC-tagged proteins was confirmed via western blot analysis (anti-MYC HRP 1:5000 (Invitrogen), anti-MYB antibody 1:5000 (Abcam) and anti-QKI 1:1000 (Bethyl Lab).
Bandopadhayay P., Ramkissoon L.A., Jain P., Bergthold G., Wala J., Zeid R., Schumacher S.E., Urbanski L., O’Rourke R., Gibson W.J., Pelton K., Ramkissoon S.H., Han H.J., Zhu Y., Choudhari N., Silva A., Boucher K., Henn R.E., Kang Y.J., Knoff D., Paolella B.R., Gladden-Young A., Varlet P., Pages M., Horowitz P.M., Federation A., Malkin H., Tracy A., Seepo S., Ducar M., Hummelen P.V., Santi M., Buccoliero A.M., Scagnet M., Bowers D.C., Giannini C., Puget S., Hawkins C., Tabori U., Klekner A., Bognar L., Burger P.C., Eberhart C., Rodriguez F.J., Hill D.A., Mueller S., Haas-Kogan D.A., Phillips J.J., Santagata S., Stiles C.D., Bradner J.E., Jabado N., Goren A., Grill J., Ligon A.H., Goumnerova L., Waanders A.J., Storm P.B., Kieran M.W., Ligon K.L., Beroukhim R, & Resnick A.C. (2016). MYB-QKI rearrangements in Angiocentric Glioma drive tumorigenicity through a tripartite mechanism. Nature genetics, 48(3), 273-282.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!