Geneelute plant genomic dna miniprep kit

The genomic DNA was extracted from young leaves of putative transgenic plants using the GeneElute Plant Genomic DNA Miniprep Kit (Sigma) according to the manufacturer’s protocol. PCR screening of transgenic plants was carried out for the HSP70 gene using the primers pair HSP70 screening FOR (5’TGGGAATCAACTGGCTGAGG) and HSP70 screening REV (5’GCAAGACCGGCAACAGGATT) designed on the coding sequence of the HSP70 gene and on the nos terminator, respectively. For nptII gene the primer pair NPTII real time FOR (5’ACTGTTCGCCAGGCTCAAGG) and NPTII real time REV (5’CCGCCAAGCTCTTCAGCAAT), designed on the coding sequence of the gene, were used. All the PCR amplifications were performed using 1x Buffer, 1.5 mM MgCl₂, 0.2 mM dNTPs, 0.4 μM primers, 1U Taq (Sigma), in a final volume of 25 μl. Thermal cycling for HSP70 screening FOR/REV was: 94°C for 1 min, 35 cycles at 94°C for 20 s, 65°C for 20 s, and 72°C for 20 s, final extension at 72°C for 10 min. For HSP70 screening FOR/REV the annealing temperature was 64°C and for NPTII real time FOR/REV was of 64°C. Electrophoresis in 2% agarose gel was carried out to detect the amplicons.

Genomic DNA was isolated from 50 ml of a two-week-old algal cell culture using the GeneElute Plant Genomic DNA Miniprep Kit (Sigma–Aldrich, Hamburg, Germany) according to the manufacturer's instructions. The nuclear gene (SSU) and two chloroplast-encoded gene (rbcL, psbC) were amplified from genomic DNA using the proof reading polymerase Phusion (Finnzymes, Thermo Scientific, Schwerte, Germany) following the PCR protocol as described in ([24] , [25] ). The primers used for amplification are listed in Table 1. PCR products were visualized in a 1% agarose gel and then purified using Exo/Sap enzyme mixture (Thermo Scientific Fermentas) and sent to oligo.pl DNA Sequencing Laboratory IBB PAS, Warsaw, Poland for Sanger sequencing with use of BigDye Terminator v. 3.1 chemistry and ABI3730 xl sequencer. For rbcL, purified PCR product has been sent to MWG Operon (now Eurofins Genomics Ebersberg, Germany) for sequencing on ABI 3730 xl machine.
The rbcL sequences for Neidium sp. NEI323TM, Neidium sp. NEI 44, Neidium sp. NEI428T and Neidium sp. NEI Baik482, and Biremis sp. were obtained by G.E. Simpson, M. Hollingsworth and A. Clark as described in ([25] ).

The total DNA was extracted from olive leaves using a GeneElute Plant Genomic DNA Miniprep Kit (SIGMA) according to the manufacturer's instructions. Samples were analyzed by selecting the best 11 ranked SSR loci [16] , which represent (at present) the most informative SSRs for olive cultivar discrimination. This method is able to distinguish among more than 99% of analyzed varieties. PCR amplifications were performed in a reaction volume of 25 μl containing 25 ng of template DNA, 10× PCR buffer, 200 μM of each dNTP, 10 pmol of each primer (forward primer labeled with FAM, NED, PET and VIC fluorescent dyes) and 2 U of Perfect Taq DNA Polymerase (5 PRIME, eppendorf). Amplifications were performed with the PCR System 9600 (Applied Biosystems, Foster City, CA, USA) using the following cycling conditions: an initial denaturation step at 95°C for 5 min, followed by 35 cycles of 95°C for 30 sec, annealing temperatures (as suggested by the authors) for 30 sec and 72°C for 25 sec, followed by a final elongation step at 72°C for 30 min. The resulting PCR products were first visualized by 2% agarose gel electrophoresis and then loaded into an ABI 3130 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Output data were analyzed using GeneMapper 3.7 (Applied Biosystems).