RILP-GFP was generated by excising RILP from pTRE2-Bla [9 (link)] and inserting into pEGFP-N1. All RILP mutants (RILP(D75A)-GFP, RILP(∆1–75)-GFP, RILP(S76/80A)-GFP, RILP(S76/80D)-GFP, RILP(∆1–75,S76/80A)-GFP, RILP(∆1–75,S76/80D)-GFP, RILP(D75A, S76/80D)-GFP were generated using Q5 Site-Directed Mutagenesis Kit (NEB). Sequences were confirmed by DNA sequencing analysis. HA-RILP-FLAG has been described elsewhere [9 (link)]. pCI-Capsase-1 was a gift from Kate Fitzgerald [13 (link)] (Addgene, 41552). shRNA Caspase-1 was a gift from Warner Greene [14 (link)] (Addgene, 53575). pSicoR-Ef1a-mCh was a gift from Bruce Conklin [15 (link)] (Addgene, 31847). pEGFP-p150Glued was a gift from David Stephens [16 (link)] (Addgene, 36154).
Psicor ef1a mch
Manufactured by Addgene
PSicoR-Ef1a-mCh is a plasmid designed for expression of mCherry protein under the control of the Ef1a promoter. It can be used for fluorescent protein expression in cells.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using psicor ef1a mch
1
Generation and Characterization of RILP Mutants
2
Lentiviral Knockdown and Rescue of Kap1 and Zfp30
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pLKO.1-based shRNA was purchased from Sigma.
>mouse shZfp30_1 (sigma: TRCN0000084321)
CCTGTTAGTCTCTATCAGAAA > mouse shZfp30_2 (sigma: TRCN0000084322)
CGTGGGAAATAATGGGAAGAA > mouse shZfp30_3 (sigma: TRCN0000084318)
GCCATGATAGACTGGCTTGTA > mouse shKap1 (Sigma: TRCN0000071363)
CCGCATGTTCAAACAGTTCAA > human shZFP30-1 (sigma: TRCN0000107910)
CCTCCTAATGTGCTACAGTAA > human shZFP30-2 (sigma: TRCN0000107911)
GCCTTTAGAGTTAGAGGACAC > human shZFP30-3 (sigma: TRCN0000107912)
CGTCGTTACTCAGAACTTATT > human shZFP30-4 (sigma: TRCN0000107913)
CGACAACAACTTACTTTCCAT > human shZFP30-5 (sigma: TRCN0000107914)
AGTACGACAACAACTTACTTC
The lentivirus vector for KAP1 KD and rescue was described previously66 (link). They derived from the pSicoR-Ef1a-mCh (Addgene #31847). Hairpin sequence against murine Kap1 (5′-CCGGCCGCATGTTCAAACAGTTCAACTCGAGTTGAACTGTTTGAACATGCGGTTTTTG-3′) or firefly luciferase (fLuc) were cloned in the HpaI/XhoI sites for creating the shControl and shKap1 lentiviral vectors, respectively. For the rescue-Kap1 plasmid, a Kap1 CDS containing a codon-optimized shRNA-resistant was cloned in the shKap1-bearing pSicoR-Ef1a-mCh vector to replace mCherry CDS. The rescue-ZFP30 (human) plasmids with human shZFP30-1 were generated in the same manner.
>mouse shZfp30_1 (sigma: TRCN0000084321)
CCTGTTAGTCTCTATCAGAAA > mouse shZfp30_2 (sigma: TRCN0000084322)
CGTGGGAAATAATGGGAAGAA > mouse shZfp30_3 (sigma: TRCN0000084318)
GCCATGATAGACTGGCTTGTA > mouse shKap1 (Sigma: TRCN0000071363)
CCGCATGTTCAAACAGTTCAA > human shZFP30-1 (sigma: TRCN0000107910)
CCTCCTAATGTGCTACAGTAA > human shZFP30-2 (sigma: TRCN0000107911)
GCCTTTAGAGTTAGAGGACAC > human shZFP30-3 (sigma: TRCN0000107912)
CGTCGTTACTCAGAACTTATT > human shZFP30-4 (sigma: TRCN0000107913)
CGACAACAACTTACTTTCCAT > human shZFP30-5 (sigma: TRCN0000107914)
AGTACGACAACAACTTACTTC
The lentivirus vector for KAP1 KD and rescue was described previously66 (link). They derived from the pSicoR-Ef1a-mCh (Addgene #31847). Hairpin sequence against murine Kap1 (5′-CCGGCCGCATGTTCAAACAGTTCAACTCGAGTTGAACTGTTTGAACATGCGGTTTTTG-3′) or firefly luciferase (fLuc) were cloned in the HpaI/XhoI sites for creating the shControl and shKap1 lentiviral vectors, respectively. For the rescue-Kap1 plasmid, a Kap1 CDS containing a codon-optimized shRNA-resistant was cloned in the shKap1-bearing pSicoR-Ef1a-mCh vector to replace mCherry CDS. The rescue-ZFP30 (human) plasmids with human shZFP30-1 were generated in the same manner.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!