Superscript iiitm reverse transcriptase

The RNA from IC was isolated by TRIzol reagent (Gibco-Invitrogen, Grand Island, NY, USA) according to a modified protocol^{51 (link)}. SuperScript III^TM reverse transcriptase (Invitrogen) was used with random hexamers to synthesize the first strand of complementary DNA (cDNA) and a SYBR Green I real-time PCR method was followed. The 2^−ΔΔCt was calculated for relative quantification and for internal calibration GAPDH was used. The primers used in this study were LC3B-II (Forward: 5′-CTT TGG GTG CGA CTT GAC G-3′, Reverse: 5′-GTC GAC CCC GCT CCT TTT-3′) and ATG5 (Forward: 5′-AGG AGA GCC TGT ACC TAT GGA-3′, Reverse: 5′-TTC TCT GTT GCG CTT TTC TGA-3′).

Total RNA was isolated from differentiated human iPS cells aggregates at day 30 of each differentiation protocol using Trizol (Invitrogen) and RNeasy micro-kits (Qiagen, Valencia, CA, USA). Complementary DNA was then synthesized using SuperScript IIITM reverse transcriptase (Invitrogen, CA, USA), and quantitative RT-PCR was performed using Taqman Universal PCR Mastermix (applied biosystems, Foster, MA, USA) and FAM-dye-labeled customized primers (Macrogen, Seoul, Korea). The following primer sequences were used: Cytokeratin (CK) 3 (sense, 5′-CTTCAACACCCGCTTTGTCA-3′; antisense, 5′-GGAGACAGACACCTTTCCCA-3′), CK12 (sense, 5′-TTCTGCTGCTTCCATGTTTG-3′; antisense, 5′-TCATTGCCCGAGAGAATACC-3′), ABCG2 (sense, 5′-ACCATTGCATCTTGGCTGTC-3′; antisense, 5′-CGATGCCCTGCTTTACCAAA-3′), ∆Np63α (sense, 5′-GCATTGTCAGTTTCTTAGCGAG-3′; antisense, 5′-CCATGGAGTAATGCTCAATCTG-3′), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (sense, 5′-GCCAAGGTCATCCATGACAAC-3′; antisense, 5′-GTCCACCACCCTGTTGCTGTA-3′). One µL of cDNA was loaded into each well, and the GAPDH gene was used as an endogenous reference. The results were analyzed by the comparative threshold cycle (CT) method, and the relative expression level of each gene was expressed as the fold change relative to control cells (iPS cells grown only in PI-medium without BMP4).

In total, 250 ng of DNAse-treated RNA were reverse transcribed with random hexamers (Invitrogen #N8080127) using SuperScript III^TM Reverse Transcriptase (Invitrogen #18080093) in a final volume of 20 μl at 50 °C for 1 h. Control reactions lacking the enzyme were systematically run in parallel as negative controls.

Total RNA was extracted with the RNeasy Mini Kit (Qiagen). cDNA was generated from 400 ng of total RNA, using Superscript III^TM reverse transcriptase (Invitrogen) and 2.5-μM T20 primers according to the manufacturer’s instructions (+RT). As control for the presence of genomic DNA, equivalent reactions were made in the absence of reverse transcriptase (−RT). Quantitative real time PCR (qRT-PCR) was performed in duplicate from a 1:5 dilution of the stock cDNA, with a home-made SYBR Green Master Mix, with the LightCycler 96 System (Roche). The concentration of primers in the reaction was previously optimized to achieve 95–105% efficiency. Five microliters of an equimolar solution containing both forward and reverse primers were added to the reaction. Relative differences in RNA levels were calculated according to the 2^−ΔΔCt method^{54 (link)} and normalized against either 18S ribosomal RNA, peptidylprolyl isomerase A (ppia) mRNA or Kanamycin-resistance (Km) mRNA. The sequences of the primers were (5′–3′): 18S_f: GAAACTGCGAATGGCTCATTAAA; 18S_r: CCACAGTTATCCAAGTAGGAGAGGA; ppia_f: GTCAACCCCACCGTGTTCTT; ppia_r: CTGCTGTCTTTGGAACTTTG; KmR_f: TGCCTGCTTGCCGAATATCA; KmR_r: ATATCACGGGTAGCCAACGC; LacZ_f: CGCTGGATAACGACATTGGC; LacZ_r: TCGTAATCAGCACCGCATCA; Stau2_f: GAACATCTCCTGCTGCTGAAG; Stau2_r: ATCCTTGCTAAATATTCCAGTTGT.