Pro q emerald 300

Bacteria were cultured to A₆₀₀ ~0.5. One milliltre was harvested by centrifugation, washed with PBS, then repelleted and resuspended in a volume of 1× Novex Tricine SDS sample buffer (Invitrogen) normalized for cell density (50 µl per 1 ml A₆₀₀ 0.5). Samples were boiled for 15 min and either cooled on ice (no proteinase K) or incubated with proteinase K (NEB) at 55 °C for 1 h. Samples were re-boiled and electrophoresed using the tricine buffer system with Novex tricine 16%-acrylamide gels (Invitrogen). Spectra Multicolor Low Range Protein Ladder (Thermo) was included to indicate approximate molecular weights. Gels were fixed, washed, stained using Pro-Q Emerald 300 (Invitrogen), and imaged using UV transillumination (Biorad Chemidoc MP). Gels were subsequently stained with Coomassie Brilliant Blue for detection of total protein. Image lab software (Biorad) was used to quantify LOS or total protein intensity levels. Samples were normalized by dividing the LOS intensity level of each band region by the total protein level from Coomassie staining. Relative values were calculated by dividing each normalized LOS value by the total normalized LOS levels in WT.

Virulent, low passage L. interrogans serovar Copenhageni strain Fiocruz L1-130 were transformed by conjugation with conjugative E. coli β2163 cells containing the plasmids pMaOri.dCas9sgLipL32 or pMaOri.dCas9sgLigAB for silencing of LipL32 and both LigA and LigB, respectively. As a no-silencing control, pMaOri.dCas9 was also used. Protospacers contained in sgRNA cassettes to target genes encoding LipL32, LigA, and LigB, conjugation protocols and mutant recovery were previously described by Fernandes et al. (2021) (link). Mutants were confirmed by PCR with primers pMaOri2 F (5′ACGCAATGTATCGATACCGAC 3′) and R (5′ATAGGTGAAGTAGGCCCACCC 3′) flanking the sgRNA cassette and by immunoblotting of cell extracts (5 × 10⁷ cells/lane) with rabbit polyclonal anti-LipL32, anti-LigAB Fernandes and anti-LipL41 (loading control). Lipopolysaccharide was visualized by staining bacterial cell extracts (5 × 10⁷ cells) with Pro-Q Emerald 300 (Invitrogen, CA, United States) as per the manufacturer’s guidelines. For downstream experiments, including animal infection, all mutants, and wild type containing pMaOri.dCas9 without sgRNA, were synchronized regarding their in vitro passage and conjugation experiments.

 SDS Loading buffer was added to 100 µL of fraction to a final concentration of 1X. 2 units of proteinase K was then added and samples incubated overnight at 55°C. 10 µL of sample were separated via SDS-PAGE using a 10% polyacrylamide gel. Staining for LPS was done using ProQ-Emerald 300 per manufacturer instructions (Invitrogen).