The largest database of trusted experimental protocols

27 protocols using anti caspase 9

1

Western Blot Protein Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Protein concentration of the cell lysates was determined using a Bradford assay (Thermo Scientific, Rockford, IL, USA). Cell lysates were separated by SDS-PAGE, and transferred to PVDF membranes (Millipore). Membranes were probed using the following primary antibodies: anti-ESET (Proteintech, 1 : 1500), anti-Caspase9 (Proteintech; 1 : 1000), anti-H3K9me3 (Millipore, 1 : 2000), anti-Caspase3 (Santa Cruz and Proteintech, 1 : 1000), anti-PLZF (Santa Cruz, 1 : 1000), anti-GFP (Beyotime, 1 : 1000) and anti-PARP (Cell Signaling Technology, Danvers, MA, USA; 1 : 1000). Secondary antibodies were horseradish peroxidase-linked anti-rabbit or anti-goat antibody (Abcam, Cambridge, UK; 1 : 5000). Protein bands were visualized on a Bio-Rad Chemidoc XRS using a Western Bright ECL Kit (Advansta, Menlo Park, CA, USA).
+ Open protocol
+ Expand
2

Porcine Reproductive Virus Research Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
VERO (ATCC®CRL-1586) and PK-15 cells (ATCC®CCL-33) were cultured in Dulbecco’s modified Eagle’s medium (CORNING, USA) supplemented with 10% fetal bovine serum (Gibco) at 37°C in a humidified atmosphere containing 5% CO2. The PRV strain ZJ 01 was isolated from a pig herd at China in 2012 (Gu et al., 2015 (link)), which was used for all experiments. The PRV were proliferated in PK-15 cells and stored at −80°C. β-Streptococcus equinus strain SheepZ001 were cultured in Tryptone soybean broth (TSB) + 0.05% fetal bovine serum (FBS) medium at 37°C, 220 rpm. Pasteurella multocida HB01 (Serotype A) were cultured in Brain-heart extract broth (BHI) medium at 37°C, 220 rpm. Bacillus subtilis 168, WB800 and other Bacillus subtilis group isolated from sheep nasal cavity were cultured in Luria-Bertani (LB) medium at 37°C, 220 rpm. Anti-PRV gB-protein monoclonal antibodies (1B1, prepared and stored in our laboratory), anti-GAPDH antibody (Proteintech), anti-cytokeratin18 (Abcam), anti-claudin 1(Abcam), anti-caspase3 (Proteintech); anti-caspase9 (Proteintech); anti-ISG15 antibody (Abcam), anti-PCNA antibody (Abcam), anti-CD3 antibody (Dako), anti-IgA antibody (Abcam) and anti-CD208 antibody (Dendritics) was used in the study.
+ Open protocol
+ Expand
3

Western Blot Analysis of Apoptosis Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were lysed with 1 mL ice-cold lysis buffer (1% triton x-100, 20 mm Tris-Hcl, ph 7.5, 150 mm NaCl, 10 mm naf, 1 mm Na3vo4, 10 mm PMSF, 1 mm benzaminidine, 5 mg/mL aprotinin, 3 mg/mL pepstatin, 5 mg/mL leupeptin). The cell lysate was centrifuged at 15,000 rpm, 4 °C for 20 min. Next, the protein concentration was measured using BCA protein assay (Beyotime, Beijing, China). The proteins were heated at 100 °C for 10 min, and then equal amount of protein per group was resolved on 10% SDS-PAGE gel. Next, the proteins were transferred to nitrocellulose (NC) membranes. Thereafter, the membranes were blocked with 5% skim milk for 2 hrs at room temperature and incubated with the following primary antibodies: rabbit anti-Caspase-3 (1:500 dilution; Proteintech, America), anti-Caspase-9 (1:300 dilution; Proteintech, Wuhan, China), anti-Bcl-2 (1:1000 dilution; Proteintech, America), anti-Bax (1:6000 dilution; Proteintech, Wuhan, China), anti-Cytc (1:5000 dilution; ABCAM, Britain), and mouse anti-β-actin (1:2000 dilution; Cell Signaling Technology, Shanghai, China). Subsequently, the NC membranes were washed and incubated with the corresponding goat anti-mouse or anti-rabbit IgG-HRP (Bioworld Technology, China) at room temperature for 2 h. Finally, the immunoreactive signals were detected with SuperSignal ECL (Pierce, Rockford, IL, USA).
+ Open protocol
+ Expand
4

Immunohistochemical Analysis of Apoptosis Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tumors excised from mice were fixed in 10% formalin, embedded in paraffin, and cut into 4-mm sections. Deparaffinized tumor sections were treated with 3% H2O2 for 10 min to block endogenous peroxidases and incubated with 5% blocking serum (goat serum) at room temperature for 30 min. After blocking, the slides were incubated with polyclonal rabbit anti-Caspase-3 (1:200 dilution; Proteintech, America), anti-Caspase-9 (1:100 dilution; Proteintech, Wuhan, China), anti-Bcl-2 (1:200 dilution; Proteintech, America), anti-Bax (1:200 dilution; Proteintech, Wuhan, China), and anti-Cytc (1:250 dilution; ABCAM, Britain) overnight at 4°C. The sections were then incubated for 1 h with a biotin labeled secondary antibody, followed by avidin-peroxidase reagent and 3,3ʹ-diaminobenzidine (DAB; Fuzhou, China) substrate. After hematoxylin counterstaining and dehydration, the sections were sealed with cover slips. Finally, the stained setions were observed under a microscope.
+ Open protocol
+ Expand
5

Analyzing Cisplatin-Induced Apoptosis Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells transfected with either control siRNA or siR-β-catenin were cultured with or without cisplatin for 24 h. Subsequently, the cells were lysed with radioimmunoprecipitation assay lysis buffer (cat. no. P0013B; Beyotime Institute of Biotechnology) with protease and phosphatase inhibitors. Protein content was determined by a Bradford protein kit (cat. no. P0012S; Beyotime Institute of Biotechnology). The proteins (30 µg/lane) were separated by 10% SDS-PAGE (cat. no. P0012A; Beyotime Institute of Biotechnology) and transferred onto PVDF membranes (EMD Millipore). Following blocking with 5% non-fat milk for 1 h at room temperature, the membranes were incubated overnight at 4°C with the following antibodies: Anti-β-catenin (cat. no. 17565-1-AP; 1:4,000; ProteinTech Group, Inc.), anti-c-Myc (cat. no. 10828-1-AP; 1:2,000; ProteinTech Group, Inc.), anti-cyclin D1 (cat. no. 26755-1-AP; 1:1,000; ProteinTech Group, Inc.), anti-caspase 3 (cat. no. 19677-1-AP; 1:600; ProteinTech Group, Inc.), anti-caspase 9 (cat. no. 10380-1-AP; 1:800; ProteinTech Group, Inc.) and anti-β-actin (cat. no. 20536-1-AP; 1:800; ProteinTech Group, Inc.), followed by horseradish peroxidase-conjugated AffiniPure donkey anti-rabbit IgG (H+L) (cat. no. SA00001-9; 1:4,000; ProteinTech Group, Inc.) at 4°C for 2 h. The band intensity was tested using ImageJ v.1.47 software (National Institutes of Health).
+ Open protocol
+ Expand
6

Mitochondrial Dysfunction and Cell Death

Check if the same lab product or an alternative is used in the 5 most similar protocols
TMZ, Compound C, AICAR, Mdivi1, MG132 and WY14643, were purchased from MedChemExpress company. MTT and N‐Acetyl‐L‐cysteine (NAC) were purchased from Sigma‐Aldrich. MitoTracker™ Red FM (M22425), Hoechst 33342 (H1399) and anti‐Ubiquitin WB Antibody (13–1600) were purchased from Invitrogen (Thermo Fisher Scientific, Inc.) (1:1,000). Anti‐phospho‐Ubiquitin (Ser65) (ABS1513‐I) was purchased from Merck KGaA company (1:1000). Anti‐P53 (21891–1‐AP), anti‐PINK1 (23274–1‐AP), anti‐Parkin (14060–1‐AP), anti‐Drp1 (12957–1‐AP), anti‐Opa1 (27733–1‐AP), anti‐Mfn1 (13798–1‐AP), anti‐Mfn2 (12186–1‐AP), anti‐Caspase‐9 (10380–1‐AP), anti‐BAX (50599–2‐Ig), anti‐Caspase‐3 (19677–1‐AP), anti‐VDAC1 (10866–1‐AP), anti‐Lamin B (12987–1‐AP), anti‐Cytochrome c (10993–1‐AP), and anti‐β‐actin (60008–1‐Ig) were purchased from ProteinTech Group, Inc., (Chicago, IL, USA) (1:1,000). Anti‐γ‐H2A.X (ab81299) was purchased from Abcam (1:1000). Anti‐AMPKα (2532) and p‐AMPKα (50081) were purchased from Cell Signaling Technology, Inc. (Massachusetts, USA) (1:1000). Anti‐phospho‐DRP1(Ser616) (DF2972) was purchased from Affinity Biosciences (1:1000). Anti‐phospho‐DRP1(Ser637) (6319S) was purchased from Cell Signaling Technology, Inc. (1:1,000).
+ Open protocol
+ Expand
7

Phloretin and AMPK Inhibitor Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
A stock solution of phloretin (analytical grade, purity 98%) was purchased from Yuanye Biotech. Co. (Shanghai, China) and Compound C (MedChemExpress, United States), an inhibitor of AMPK, was prepared in dimethyl sulfoxide (DMSO). In all experiments, DMSO was diluted to less than 0.1% (w/v) by phosphate buffered saline (PBS) and further diluted in growth medium (Yang et al., 2018 (link)).
Antibodies, including anti-phospho-AMPKα (Thr172), anti-proliferating cell nuclear antigen (PCNA), anti-Cyclin D1, anti-GAPDH, and goat anti-rabbit and anti-mouse secondary antibody, were purchased from Cell Signaling Technology (Shanghai, China); anti-β-actin, anti-caspase 3, anti-caspase 9, and anti-Keap1 were obtained from Proteintech (Hubei, China); and anti-nuclear factor erythroid 2-related factor 2 (Nrf2), anti-phospho-Nrf2 (Ser40), anti-phospho-LKB1 (Ser428), and anti-heme oxygenase-1 (HO-1) were obtained from Santa Cruz Biotechnology (United States).
+ Open protocol
+ Expand
8

Western Blot Protein Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total protein was extracted using a bicinchoninic acid (BCA) assay kit by lysing cell precipitates with RIPA lysis buffer for 10–20 min on ice or at 4°C, followed by centrifugation at 12 000 × g for 15 min at 4°C. The protein lysate was diluted in 5X loading buffer and denatured by boiling at 100°C for 5–10 min. Protein samples (60 μg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene difluoride (PVDF) membrane by membrane transfer on ice at 250 mA. They were blocked with 5% nonfat milk for 1–2 h followed by incubation with primary antibodies overnight at 4°C in an orbital shaker. The membrane was incubated with goat anti-rabbit or anti-mouse IgG secondary antibody for 1–2 h at 4°C on an orbital shaker after primary antibody was washed off. Finally, the membrane was visualized with a chemiluminescence imager and exposed to the enhanced chemiluminescence (ECL) dye solution.
Primary antibodies used included: anti-SQLE (Proteintech, Cat# 12544–1-AP), anti-β-actin (BIOX, Cat# BX-009), anti-caspase 3 (CST, Cat# 9662S), anti-cleaved caspase 3 (CST, Cat# 9664T), anti-caspase 9 (Proteintech, Cat# 10380–1-AP), anti-GPX4 (CST, Cat# 52455S), anti-xCT (abcam, ab175186), anti-Bcl2 (CST, Cat# 15071T), and anti-BAX (CST, Cat# 5023T).
+ Open protocol
+ Expand
9

Investigating Ferroptosis Regulators in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
6-isopropyl dithio-2′-dexoxyguanosine (YLS004) and 6-isopropyl dithio-2′-guanosine (YLS010) were obtained from Chemipanda Bio-Tech Co., Ltd. (Hangzhou, China). 6-Thioguanine(6-TG) was purchased from Aladdin (Shanghai, China). Nelarabine was purchased from Market-Guide Pharmaceutical & Chemical Co., Ltd. (Jiangxi, China). Anti-BAX (Abcam, Cambridge, UK, Cat# ab182733, dilution ratio: 1:2000). Anti-BCL-2(Abcam, Cambridge, UK, Cat# ab32124, dilution ratio: 1:2000). Anti-Caspase 3 (Proteintech, Chicago, IL, USA, Cat# 19677-1-AP, dilution ratio: 1:1000). Anti-Caspase9 (Proteintech, Cat# 10380-1-AP, dilution ratio: 1:1000). Anti-GPX4 (Proteintech, Cat# 67763-1-lg, dilution ratio: 1:2000). Anti-ACSL4 (Proteintech, Cat# 66617-1-lg, dilution ratio: 1:5000). Anti-GAPDH (Proteintech, Cat# 60004-1-lg, dilution ratio: 1:5000).
+ Open protocol
+ Expand
10

Transfection and Western Blot for PHGDH Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were transfected with siRNA using Lipofectamine 3000 reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) along with the manufacturer's procedure within 24 h after seeded in the 6‐well culture plates. RNA and total protein were extracted 48 or 72 h after transfection for further analysis. The efficiency of transfection was validated by western blot and real‐time qPCR. Western blot was conducted as previously described.21 Antibodies used in the present study were: anti‐PHGDH (Proteintech, 14719‐1‐AP), anti‐β‐actin (Proteintech, 60008‐1‐Ig), anti E‐cadherin (Proteintech, 20874‐1‐AP), anti‐vimentin (Proteintech, 60330‐1‐Ig), anti‐caspase‐3 (Proteintech, 66470‐2‐Ig), anti‐Zeb1 (CST, 70512T), anti‐β‐catenin (CST, #9562), anti‐N‐cadherin (abcam, ab76011), anti‐Snail (CST, 3879T), anti‐caspase‐9 (Proteintech, 66169‐1‐Ig), anti‐Bax (Proteintech, 50599‐2‐Ig), and anti‐Bcl‐2 (Proteintech, 60178‐1‐Ig). Real‐time qPCR was conducted along with the manufacturer's protocols. Primers used were PHGDH (Forward: GAATGATCATGTGCCTGGC; Reverse: GTTCCCATGAACTTCTTCCG).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!