RNA isolation was performed using a RNeasy kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Following the isolation procedure, 1 µg RNA was used for reverse transcription using a RevertAid H Minus reverse transcriptase kit (Fermentas, Waltham, MA, USA) or a high-capacity cDNA kit (Thermo Fisher Scientific, Waltham, MA, USA). RT-PCR was performed using a ViiA 7 PCR system (Applied Biosystems, Waltham, MA, USA), and relative mRNA concentrations were normalized to β-actin (Actb) using the ΔΔCt method. The mouse primer sequences used in this study are listed in Table 2 .
Revertaid h minus reverse transcriptase kit
Manufactured by Thermo Fisher Scientific
Sourced in United States, Canada, United Kingdom
The RevertAid H Minus Reverse Transcriptase kit is a laboratory tool used for the synthesis of complementary DNA (cDNA) from RNA templates. The kit includes a reverse transcriptase enzyme, which catalyzes the conversion of RNA into single-stranded cDNA, a crucial step in various molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (7 mentions)
Rneasy kit, by Qiagen (3 mentions)
Thermocycler, by Thermo Fisher Scientific (3 mentions)
Itaq univer sybr green supermix, by Bio-Rad (3 mentions)
Viia7 pcr system, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr kit, by Qiagen (2 mentions)
Dnase 1, by Thermo Fisher Scientific (2 mentions)
Brilliant 2 sybr green qpcr master mix, by Agilent Technologies (2 mentions)
Rnase inhibitor, by Thermo Fisher Scientific (2 mentions)
Cfx software, by Bio-Rad (2 mentions)
Maxima sybr green rox qpcr master mix, by Thermo Fisher Scientific (2 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
High capacity cdna kit, by Thermo Fisher Scientific (1 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
Power sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Viia 7 system, by Thermo Fisher Scientific (1 mentions)
Rotor gene q, by Qiagen (1 mentions)
Rna extraction kit, by Qiagen (1 mentions)
Random hexamer, by Thermo Fisher Scientific (1 mentions)
29 protocols using revertaid h minus reverse transcriptase kit
1
RNA Isolation and RT-PCR Analysis
2
Testicular RNA Isolation and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNeasy Plus Minikit (Qiagen, Valencia, CA) was used to purify the total RNA from the testicular tissues. cDNA was prepared using the RevertAid™ H Minus Reverse Transcriptase kit (Fermentas, Thermo Fisher Scientific Inc., Canada). For real-time PCR analysis, samples of cDNA were run in triplicate. The reaction was performed using the Power SYBR® Green Mastermix (Life Technologies, CA) on an Applied Biosystems 7500 system. The PCR cycling thermal conditions were established as follows: preliminary denaturation at 95°C for 12 min, then by 45 cycles of denaturation at 94°C for 60 s and annealing at 55°C for 60s, extension at 72°C for 90 s, and afterwards held for a final extension at 72°C for 10 min. Gene expression values were normalized against Actb. The primer sequences and accession numbers for each of these genes are provided in Table 1 .
3
Quantifying mRNA Levels in Cells and Organs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from organs using TRIzol reagent (Life Technologies, Carlsbad, USA) and from cells using the RNeasy kit (Qiagen, Hilden, Germany) according to the manufacturers’ instructions. Reverse transcription of 1 000 ng RNA from both cells and organs was performed using the RevertAid H Minus reverse transcriptase kit (Fermentas, Waltham, USA). qPCR was performed on a ViiA 7 system (Applied Biosystems, Waltham, USA), and the relative mRNA concentrations normalized to that of β-actin were calculated by the 2−ΔΔCt method. The primer sequences used in qPCR are shown in Table S8 .
4
Quantification of CRP and IL-6 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from treated RAW 264.7 cells using Qiagen RNA extraction kit (Qiagen, Germantown, MD, USA) following the manufacturer’s instructions. For mRNA analysis, reverse transcription was performed using RevertAid™ H Minus Reverse Transcriptase kit (Fermentas, Thermo Fisher Scientific Inc., Canada). To quantify mRNA of CRP and IL-6 expression, BioRad syber green PCR MMX was used with CRP, IL-6, and the housekeeping gene ACTB specific RT primers (Table 7 ). The gene transcripts were measured by quantitative real-time PCR (qPCR) using a Rotor-Gene Q (QIAGEN Hilden, Germany). All experiments were performed in triplicate. Fold change was calculated using the 2−ΔΔCt method.
Primers for mRNA.
| Gene | Primers | Sequence |
|---|---|---|
| IL6 | Forward | 5′-AGACAGCCACTCACCTCTTCAG-3′ |
| Reverse | 5′-TTCTGCCAGTGCCTCTTTGCTG-3′ | |
| CRP | Forward | 5′GAACTTTCAGCCGAATACATCTTTT3′ |
| Reverse | 5′-CCTTCCTCGACATGTCTGTCT-3′ | |
| ACTB | Forward | 5′-GCACCACACCTTCTACAATG-3′ |
| Reverse | 5′-TGCTTGCTGATCCACATCTG-3′ | |
5
Quantitative RT-PCR Analysis of Mosquito Transgenics
6
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA (1 μg, n = 10 samples per group) was used to synthesise cDNA with the RevertAid H Minus Reverse Transcriptase kit (Fermentas, Loughborough, UK). Quantification of gene expression was performed using the ABI Prism 7900 system (Applied Biosystems, Foster City, CA, USA) and primers for SYBR Green or TaqMan probes (Applied Biosystems) (ESM Table 2 ). Fold changes in gene expression were calculated using the REST 2009 programme (Qiagen, Manchester, UK) and normalised against Ppia, Taf2 and Hmbs, identified as good internal controls from the microarray data.
7
Nrf2 mRNA Expression Quantification in Kidney
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Using
the Qiazol reagent and the manufacturer’s recommendations,
total RNA was extracted from freshly isolated kidney tissues (Qiagen,
Germantown, MD, USA). The RevertAid H Minus Reverse Transcriptase
kit (Fermentas, Thermo Fisher Scientific Inc., Canada) was used to
synthesize cDNA in accordance with the manufacturer’s instructions
after a Nanodrop was used to measure RNA quantities. The SYBR green
PCR kit was used to determine the Nrf2 mRNA levels (Qiagen, Germany).
The quantitative PCR was carried out in duplicate on the ViiATM 7
PCR equipment (Applied Biosystems, USA). The relative levels of Nrf2
mRNA were calculated using the 2–ΔΔCt method and normalized to the mRNA level of the GAPDH housekeeping
gene. The Nrf2 primer sequences were forward 5′-CAG CAT GAT
GGA CTT GGA ATT G-3′ and reverse 5′-GCA AGC GAC TCA
TGG TCA TC-3′, and the primer sequences for glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) were forward 5′-AGT GCC AGC CTC GTC TCA
TA-3′ and reverse 5′-TCC CGT TGA TGA CCA GCT TC-3′.
the Qiazol reagent and the manufacturer’s recommendations,
total RNA was extracted from freshly isolated kidney tissues (Qiagen,
Germantown, MD, USA). The RevertAid H Minus Reverse Transcriptase
kit (Fermentas, Thermo Fisher Scientific Inc., Canada) was used to
synthesize cDNA in accordance with the manufacturer’s instructions
after a Nanodrop was used to measure RNA quantities. The SYBR green
PCR kit was used to determine the Nrf2 mRNA levels (Qiagen, Germany).
The quantitative PCR was carried out in duplicate on the ViiATM 7
PCR equipment (Applied Biosystems, USA). The relative levels of Nrf2
mRNA were calculated using the 2–ΔΔCt method and normalized to the mRNA level of the GAPDH housekeeping
gene. The Nrf2 primer sequences were forward 5′-CAG CAT GAT
GGA CTT GGA ATT G-3′ and reverse 5′-GCA AGC GAC TCA
TGG TCA TC-3′, and the primer sequences for glyceraldehyde-3-phosphate
dehydrogenase (GAPDH) were forward 5′-AGT GCC AGC CTC GTC TCA
TA-3′ and reverse 5′-TCC CGT TGA TGA CCA GCT TC-3′.
8
Quantification of SOCS gene expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression of socs genes was quantified by real-time RT-PCR. RNA was reverse transcribed using the random primers included in the RevertAid H Minus Reverse Transcriptase kit (Fermentas). The reaction mixture was incubated at 25°C for 10 min, 42°C for 60 min, and 70°C for 10 min. Real-time RT-PCR was performed using SYBR Green/ROX-PCR master mix (Fermentas). RNase P was used as an endogenous expression control in all experiments.
Dynamic range for socs1 and socs3 with respect to RNase P was calculated for both genes at 50–200 ng, giving a linear slope of 0.03 and 0.009, respectively. Assay specificity was confirmed by the dissociation curves corresponding to each gene.
The primers used were socs1 Forward 5′-CAC GCA CTT CCG CAC ATT CC-3′, socs1 Reverse 5′-TCC AGC AGC TCG AAG AGG CA-3′, socs3 Forward 5′-ACA ATC TGC CTC AAT CAC TCT G 3′, and socs3 Reverse 5′-TTG ACT TGG ATT GGG ATT TTG-3′.
All reactions were run in duplicate by using a StepOne Real-Time PCR system (Applied Biosystems). The mRNA expression level between T0 and Tn was expressed as an n-fold increase according to the formula to calculate relative expression 2−ΔΔCT ± SD, where ∆CT is the difference in the threshold between any target gene (socs1 or socs3) and the endogenous gene (RNase P) and ∆∆CT establishes the differences between study and control group conditions.
Dynamic range for socs1 and socs3 with respect to RNase P was calculated for both genes at 50–200 ng, giving a linear slope of 0.03 and 0.009, respectively. Assay specificity was confirmed by the dissociation curves corresponding to each gene.
The primers used were socs1 Forward 5′-CAC GCA CTT CCG CAC ATT CC-3′, socs1 Reverse 5′-TCC AGC AGC TCG AAG AGG CA-3′, socs3 Forward 5′-ACA ATC TGC CTC AAT CAC TCT G 3′, and socs3 Reverse 5′-TTG ACT TGG ATT GGG ATT TTG-3′.
All reactions were run in duplicate by using a StepOne Real-Time PCR system (Applied Biosystems). The mRNA expression level between T0 and Tn was expressed as an n-fold increase according to the formula to calculate relative expression 2−ΔΔCT ± SD, where ∆CT is the difference in the threshold between any target gene (socs1 or socs3) and the endogenous gene (RNase P) and ∆∆CT establishes the differences between study and control group conditions.
9
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fermentas RevertAid H MinusReverse transcriptase kit and 5 mM oligo(dT)18 were used to synthesize cDNA from 1 μg of total RNA. Quantitative RT‐PCR was performed on the ABI‐7500 (7500 Real‐Time PCR Systems; Applied Biosystems, now ThermoFisher Scientific) with an RNA equivalent of 10 ng of cDNA and HOT FIREPol EvaGreen qPCR mix with ROX (Solis BioDyne, https://solisbiodyne.com ). Normalization was performed with EF1a (Mallona et al., 2010 (link)) or FBP1 (Shaipulah et al., 2016 (link)) as a housekeeping gene. Primers are listed in Table S6 .
10
Renal Total RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from renal tissues using a TRIzol reagent kit (Qiagen, Germantown, MD, USA); then, their concentrations were measured in nanodrops. cDNA was obtained from isolated RNA using the reverse-transcription method according to the RevertAid™ H Minus Reverse Transcriptase kit provided by Fermentas (Thermo Fisher Scienti c Inc., Canada). mRNA levels of Nos2, Nfe212, and Hmox1 were quantitatively measured using the ViiA TM 7 PCR system (Applied Biosystems, USA) using the SYBR Green PCR kit (Qiagen, Germany). The fold changes of all mRNAs were calculated using the 2 -ΔΔCt method, where they were normalized to the Actb acting as the internal control. Primer sequences of the selected genes are presented in Table 1.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!