Log In Sign up
The largest database of trusted experimental protocols

Rabbit anti ha

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

Rabbit anti-HA is an antibody that recognizes the hemagglutinin (HA) tag, a widely used protein tag. The antibody is produced in rabbits and can be used to detect and immunoprecipitate HA-tagged proteins in various experimental applications.

Automatically generated - may contain errors

Lab products found in correlation

Chemidoc mp imaging system, by Bio-Rad (4 mentions) Mouse anti ha, by BioLegend (4 mentions) Rabbit anti flag, by Merck Group (3 mentions) Lsm 780 confocal microscope, by Zeiss (3 mentions) Mouse anti v5, by Merck Group (3 mentions) Mouse anti β tubulin, by Merck Group (2 mentions) Pvdf membrane, by Merck Group (2 mentions) Western lighting plus ecl, by PerkinElmer (2 mentions) Mouse anti ha, by Merck Group (2 mentions) Tcs sp5, by Leica (2 mentions) Mouse anti flag, by Merck Group (2 mentions) Rabbit anti actin, by BioLegend (2 mentions) Odyssey infrared emsa kit, by LI COR (1 mentions) Dual luciferase reporter assay system, by Promega (1 mentions) Rabbit anti myc, by Merck Group (1 mentions) Ha 11, by Fortrea (1 mentions) Rabbit anti gfp, by Abcam (1 mentions) Cm100, by Philips (1 mentions) Mouse anti myc antibody, by Thermo Fisher Scientific (1 mentions) Alexa fluor 594 conjugated anti rabbit, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

Rabbit anti-HA pAb Rabbit anti-HA polyclonal antibody Rabbit-anti-HA antibody Polyclonal rabbit anti-HA antibodies Alexa-Fluor conjugated anti-mouse (HA tag) or anti-rabbit (Flag tag) secondary antibodies Anti-HA

27 protocols using rabbit anti ha

1

Chromatin Immunoprecipitation and Luciferase Assays

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
EMSA was performed as described before (15 (link),16 (link)) however in this experiment, we used the Odyssey® Infrared EMSA kit from LI-COR (829–07910) and a CREB IRDye® 700 Infrared labeled oligonucleotides containing a canonical CRE (5’TGACGTCA3’) (829–07923) following the manufacturer protocol. For supershift determinations, samples were co-incubated with Rabbit anti-HA (Invitrogen) for 10 minutes before running the samples on native gels.
SimpleChIP® Enzymatic Chromatin IP Kit (9003) was used for ChIP assays following the manufacturer protocol and previously described protocol (34 (link), 35 (link)) IgG was supplied with the ChIP assay kit. Anti-HA tag antibody-ChIP grade (ab9110) were purchased from ABCAM. The oligonucleotides used to amplify a 151bp sequence of the human cyclinD2 promoter containing a CRE at position −294 were (5’−3’): GAAAGGGGAGGAGGAACCAGAG and CTGCCTCACTCGCACCG.
Luciferase assay was performed as described before (21 (link)) using DUAL Luciferase® reporter assay system from Promega (E1910) was used following their specifications and performed using the firefly luciferase reporter gene with the wild type human cyclin D1 promoter as previously described (34 (link)).
DeadEnd™ Fluorometric TUNEL (TdT-mediated dUTP Nick-End Labeling) assay from Promega (TB235) was performed following the manufacturer protocol and specifications.
Cirinelli A., Wheelan J., Grieg C, & Molina C.A. (2022). Evidence that the transcriptional repressor ICER is regulated via the N-end rule for ubiquitination. Experimental cell research, 414(1), 113083.
+ Open protocol
+ Expand
2

Antibody Characterization for Parasite Research

Cited 3 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The following previously described primary antibodies were used in immunofluorescence (IFA) or Western blot assays: anti-IMC1 (monoclonal antibody [MAb] 45.15) (43 (link)), anti-ISP1 (MAb 7E8) (17 (link)), mouse anti-ISP3 (17 (link)), anti-F1 ATP synthase β subunit (MAb 5F4) (44 (link)), anti-ATrx1 (MAb 11G8) (45 (link)), anti-ROP7 (MAb 1B10) (46 (link)), rabbit anti-ROP13 (47 (link)), and rat anti-IMC3 (12 (link)). The hemagglutinin (HA) epitope was detected with mouse anti-HA (MAb HA.11) (Covance) or rabbit anti-HA (Invitrogen). The c-Myc epitope was detected with mouse anti-Myc (MAb 9E10) (NeoMarkers) or rabbit anti-Myc (Sigma).
Chen A.L., Kim E.W., Toh J.Y., Vashisht A.A., Rashoff A.Q., Van C., Huang A.S., Moon A.S., Bell H.N., Bentolila L.A., Wohlschlegel J.A, & Bradley P.J. (2015). Novel Components of the Toxoplasma Inner Membrane Complex Revealed by BioID. mBio, 6(1), e02357-14.
+ Open protocol
+ Expand
3

Immunogold Labeling of Transgenic Parasites

Check if the same lab product or an alternative is used in the 5 most similar protocols
PFE1605w-HA and PFI1780w-GFP transfected mature parasites were purified by Percoll density gradient, fixed in 2% PFA-0.2% glutaraldehyde in phosphate buffer, and prepared according to Tokuyasu (50 (link)). Ultrathin sections (70−90 nm) prepared on an FC7/UC7-ultramicrotome (Leica Microsystems) at −120°C were immunogold-labeled with rabbit anti-HA (1:20; Invitrogen) or rabbit anti-GFP (1:20; Abcam, Cambridge, UK) antibodies and 5 nM protein A-gold (1:70; UMC, Utrecht, The Netherlands). Sections were stained with 4% uranyl acetate-methylcellulose (1:9) and examined with a transmission electron microscope (CM10 or CM100; Philips, Eindhoven, The Netherlands) at 80 kV.
Oberli A., Slater L.M., Cutts E., Brand F., Mundwiler-Pachlatko E., Rusch S., Masik M.F., Erat M.C., Beck H.P, & Vakonakis I. (2014). A Plasmodium falciparum PHIST protein binds the virulence factor PfEMP1 and comigrates to knobs on the host cell surface. The FASEB Journal, 28(10), 4420-4433.
+ Open protocol
+ Expand
4

Generating Myc and HA-tagged Protein Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols
To generate N-terminal Myc-tagged c3a and c5a expression constructs, c3a and c5a genes were amplified using the primers listed in the Table 1, digested with restriction enzyme EcoR I and Xho I, and cloned into the pCMV-Myc plasmid. To generate N-terminal HA-tagged sspA-1 and sspA-2 expression constructs, truncated sspA-1T and sspA-2T genes were amplified by pCMV-sspA-1T-F/R and pCMV-sspA-2T-F/R, respectively, enzyme digested with Xho I and Kpn I and cloned into the pCMV-HA plasmid. Pairs of eukaryotic expression plasmids pCMV-HA-sspA-1T or pCMV-HA-sspA-2T and pCMV-Myc-c3a or pCMV-Myc-c5a were co-transfected into HEK-293T cells. After grown in 24 h, the cells were washed with 10 mM PBS, fixed with 4% paraformaldehyde for 30 min, permeabilized with 0.5% Triton X-100 in PBS for 10 min. After additional washes in PBS, cells were applied with rabbit anti-HA (1:1000, Invitrogen, USA) and mouse anti-Myc antibodies (1:1000, Invitrogen) at the ratio of 1:1 at 37 °C for 30 min for double-labelling, followed by Alexa Fluor 594-conjugated anti-rabbit (1:1000, Invitrogen) and 488-conjugated anti-mouse (1:1000, Invitrogen) antibodies at the ratio of 1:1 at 37 °C for 45 min. Nuclei were visualized with DAPI (Beyotime), and cells were imaged by confocal microscopy (Olympus FV3000 confocal microscope, Japan).
Deng S., Liao J., Li H., Xu J., Fan J., Xia J., Wang J., Lei L., Chen M., Han Y., Zhai R., Zhou C., Zhou R., Cheng C, & Song H. (2024). Streptococcus suis subtilisin-like serine proteases SspA-1 and SspA-2 interplay with complement C3a and C5a to facilitate bacterial immune evasion and infection. Virulence, 15(1), 2301246.
+ Open protocol
+ Expand
5

Visualizing PRRT2 Localization in Hek-Nav1.2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Hek-NaV1.2 cells transfected with PRRT2-HA, PRRT2ΔC-HA, or PRRT2ΔN-HA constructs were live labeled by diluting primary antibodies (mouse anti-HA, 1:500, Millipore) in culture medium for 30 min at 37 °C/5% CO2 to detect surface epitopes, followed by fixation with 4% paraformaldehyde and incubation with Alexa Fluor-594 secondary antibodies. After several washes in phosphate-buffered saline (PBS), coverslips were mounted using Prolong Gold antifade reagent (Invitrogen) containing 4′,6′-diamidino-2-phenylindole for nuclear staining. Hek-Nav1.2 cells transfected with PRRT2-HA, PRRT2ΔC-HA or PRRT2ΔN-HA constructs were fixed in 4% paraformaldehyde at room temperature for 20 min, washed in PBS, and blocked with 10% bovine serum albumin (BSA) for 20 min. Samples were sequentially incubated with mouse anti-pan-Nav (Sigma; 1:100 in 5% BSA) and rabbit anti-HA, (Invitrogen; 1:500 in 5% BSA) primary antibodies, followed by Alexa 564-conjugated or 488-conjugated secondary antibodies (Invitrogen; 1:200 in 5% BSA) at room temperature. After several washes in PBS, coverslips were mounted using Prolong Gold antifade reagent (Invitrogen) containing 4′,6′-diamidino-2-phenylindole for nuclear staining.
Franchi F., Marte A., Corradi B., Sterlini B., Alberini G., Romei A., De Fusco A., Vogel A., Maragliano L., Baldelli P., Corradi A., Valente P, & Benfenati F. (2023). The intramembrane COOH-terminal domain of PRRT2 regulates voltage-dependent Na+ channels. The Journal of Biological Chemistry, 299(5), 104632.
+ Open protocol
+ Expand
6

Antibody Production and Validation Protocol

Cited 6 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The following previously described primary antibodies were used in immunofluorescence (IFA) or Western blot assays: mouse anti-ISP1 (38 (link)), mouse anti-ISP3 (39 (link)), rabbit anti-IMC6 (24 (link)), mouse anti-F1β subunit (monoclonal antibody [MAb] 5F4) (40 (link)), mouse anti-ATrx1 (MAb 11G8) (41 (link)), mouse anti-ROP7 (42 (link)), mouse anti-MIC2 (43 (link)), rabbit anti-catalase (44 (link)), and guinea pig anti-NHE3 (45 (link)). The hemagglutinin (HA) epitope was detected with mouse anti-HA (MAb HA.11) (BioLegend) or rabbit anti-HA (Invitrogen). The c-Myc epitope was detected with mouse anti-Myc (MAb 9E10), and the OLLAS tag was detected using rat monoclonal anti-OLLAS (28 (link)). For production of ISC1 and ISC2 antibodies, the complete coding sequences of the genes were cloned into the pET28 and pET160 bacterial expression vectors, respectively. The constructs were transformed into BL21(DE3) E. coli, and proteins were induced with 1 mM IPTG (isopropyl-β-d-thiogalactopyranoside) and purified using nickel-nitrilotriacetic acid (Ni-NTA) agarose under denaturing conditions as described elsewhere (46 (link)). The samples were then dialyzed into phosphate-buffered saline (PBS) to remove the urea, and rat antisera against the proteins were produced by Cocalico Biologicals.
Chern J.H., Pasquarelli R.R., Moon A.S., Chen A.L., Sha J., Wohlschlegel J.A, & Bradley P.J. (2021). A Novel Toxoplasma Inner Membrane Complex Suture-Associated Protein Regulates Suture Protein Targeting and Colocalizes with Membrane Trafficking Machinery. mBio, 12(5), e02455-21.
+ Open protocol
+ Expand
7

Antibodies for Immunofluorescence and Western Blot Analysis

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The following previously described primary antibodies were used in immunofluorescence (IFA) or Western blot assays: anti-IMC1 (mAb 45.15) (Wichroski et al., 2002 (link)), anti-ISP1 (mAb 7E8) (Beck et al., 2010 ), anti-F1 ATP synthase β subunit (mAb 5F4) (Jacot et al., 2013 (link)), mouse anti-ISP3 (Beck et al., 2010 ), rabbit anti-CPL (Larson et al., 2009 (link)), rabbit anti-MORN1 (Gubbels et al., 2006 (link)) and rat anti-IMC3 (Anderson-White et al., 2011 (link)). The hemagglutinin (HA) epitope was detected with mouse anti-HA (mAb HA.11) (Covance) or rabbit anti-HA (Invitrogen). Rabbit RON5c antibody was generated using recombinant 6xHis-tagged RON5c protein that was purified as previously described (Straub et al., 2009 (link)) for polyclonal antibody production (Cocalico Biologicals). To generate rat anti-ISC1, the full coding region of ISC1 was PCR-amplified (Table S2) and cloned into the pET28a vector between EcoRI and SalI sites. The resulting 6xHis-tagged ISC1 was overexpressed and purified as previously described (Straub et al., 2009 (link)) for polyclonal antibody production (Cocalico Biologicals).
Chen A.L., Moon A.S., Bell H.N., Huang A.S., Vashisht A.A., Toh J.Y., Lin A.H., Nadipuram S.M., Kim E.W., Choi C.P., Wohlschlegel J.A, & Bradley P.J. (2016). Novel insights into the composition and function of the Toxoplasma IMC sutures. Cellular microbiology, 19(4), 10.1111/cmi.12678.
+ Open protocol
+ Expand
8

Western Blot Analysis of Protein Targets

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lysates were run on a 10% Bis Tris plus polyacrylamide gel (Thermofisher Scientific, Waltham, MA, USA) and then transferred to a PVDF membrane (Sigma-Aldrich). Membranes were blocked in 5% non-fat dried milk in 1X phosphate buffered saline with 0.1% Tween20 (PBST) and probed with the indicated antibodies. Blots were developed using Western Lighting Plus ECL (Perkin Elmer) and imaged on ChemiDoc MP Imaging System (Bio-Rad). Antibodies: rabbit anti-flag (Sigma-Aldrich, cat #F7425), rabbit anti-HA (Invitrogen, Waltham, MA, USA, cat #71-5500), mouse anti-β-tubulin (Sigma-Aldrich, cat# T8328).
Donnelly C.M., Vogel O.A., Edwards M.R., Taylor P.E., Roby J.A., Forwood J.K, & Basler C.F. (2023). Henipavirus Matrix Protein Employs a Non-Classical Nuclear Localization Signal Binding Mechanism. Viruses, 15(6), 1302.
+ Open protocol
+ Expand
9

Western Blot Analysis of Ebola Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lysates were run on 4-12% Bis Tris polyacrylamide gels (Thermofisher Scientific, Waltham, MA, USA) and transferred to a PVDF membrane Sigma (Aldrich, St. Louis, MO, USA). Five percent non-fat dry milk in phosphate buffer saline with 0.1% Tween20 (PBST) was used as blocking buffer. Blots were probed with the indicated antibodies and developed using the Western Lighting plus ECL (Perkin Elmer, Waltham, MA, USA). Blots were imaged on the Bio-Rad ChemiDoc MP Imaging System (BioRad, Philadelphia, PA, USA). Antibodies: Rabbit anti-VP24 (SinoBiological, cat #40454-T46); Mouse anti-VP35 (6C5) [52 (link)]; Mouse anti-VP40 (IBT Bioservices, cat #0201-016); Rabbit anti-VP35 (IBT Bioservices, cat #0301-040); Rabbit anti-NP (IBT Bioservices, cat #0301-012); Rabbit anti-HA (Invitrogen, cat #71-5500); β-Tubulin (Sigma Aldrich, cat #T8328); Rabbit anti-HDAC2 (Cell Signaling, cat #2540S).
Vogel O.A., Nafziger E., Sharma A., Pasolli H.A., Davey R.A, & Basler C.F. (2024). The Role of Ebola Virus VP24 Nuclear Trafficking Signals in Infectious Particle Production. bioRxiv.
+ Open protocol
+ Expand
10

Immunofluorescent Staining of N. caninum

Check if the same lab product or an alternative is used in the 5 most similar protocols
Confluent HFF were grown on glass coverslips in 24-well plates and were infected with N. caninum tachyzoites, either NC-1 isolate or different clones expressing variants of hem-agglutinin-tagged NcGRA9 (NcGRA9-HA variants). Infected cultures were maintained for different time spans, depending on the experiments as indicated in the text. The immunofluorescent staining was performed according to Guinoaud et al. (2010) with the following adaptations: methanol/acetone permeabilization for 20 min, final DAPI concentration 0.5 μg/ml, coverslips mounted in Fluoromount-G (Southern Biotech, Birmingham, USA), and analyses with Zeiss LSM 780 confocal microscope.
For immunolabeling of extracellular N. caninum tachyzoites the parasites were harvested as described above, suspended in medium and small droplets of the suspension was placed onto coverslips. The samples were air-dried and immunofluorescence staining was performed as described above.
Primary antibodies used were rabbit anti-NcGRA9 antiserum or rabbit anti-HA (Invitrogen, Carlsbad, USA), both used at a dilution of 1 : 1000. As secondary antibodies goat anti-rabbit cy2 or cy3 (Dianova, West Grove, USA) were used at 1 : 1000 dilution.
Leineweber M., Spekker-Bosker K., Ince V., Schares G., Hemphill A., Eller S.K, & Däubener W. (2017). First Characterization of the Neospora caninum Dense Granule Protein GRA9. BioMed Research International, 2017, 6746437.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!