The largest database of trusted experimental protocols

Screenfect sirna

Manufactured by Fujifilm
Sourced in Japan

ScreenFect siRNA is a transfection reagent designed for the efficient delivery of small interfering RNA (siRNA) into cells. It facilitates the uptake of siRNA molecules, enabling gene silencing studies and RNA interference (RNAi) applications.

Automatically generated - may contain errors

8 protocols using screenfect sirna

1

RXFP1 Silencing Using siRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Small interfering RNA for RXFP1 was purchased from Takara Bio (Shiga, Japan). The target sequences of siRNA against RXFP1 were as follows: siRNA-1, 5′-GGACUGAAUAGCCUUACUATT-3′ (sense), and 3′-TT CCUGACUUAUCGGAAUGAU-5′ (anti-sense); and siRNA-2, 5′-GCAGAACAAUUACAGUUC UTT-3′ (sense), and 3′-TT CGUCUUGUUAAUGUCAAGA-5′ (anti-sense). In addition, medium GC duplex #2 (Invitrogen, Carlsbad, CA, USA) was also used as a negative control (siC). siRNA, 10 nM, was transfected into cells (1 × 105 cells/mL) using ScreenFect siRNA (Wako Purechemical Industries, Osaka, Japan) for 72 h. The procedure for the ScreenFect siRNA-mediated transfection in a 48-well culture plate was as follows. The siRNA was diluted in 16 μL of buffer, was mixed with 16 μL of buffer containing 0.8 μL ScreenFect siRNA, and was then incubated for 30 min at 25 °C before being added to each well.
+ Open protocol
+ Expand
2

Atf4 siRNA Transfection in Hepa1-6 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Hepa1-6 were transfected with Atf4 siRNA (30 nmol/L) (SASI_Mm02_00316863, Merck KGaA, Darmstadt, Germany) and Non-Targeting siRNA (scramble) (MISSION® siRNA Universal Negative Control, Merck) in EMEM, using ScreenFect™siRNA (FUJIFILM Wako Chemicals, Ltd. Osaka, Japan) according to the manufacturer’s protocol. Cells were incubated with transfection reagent for 24 h before gene expression analysis.
+ Open protocol
+ Expand
3

Silencing RPL11 Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
We transfected cells with siRNA oligonucleotides in Screen Fect Dilution Buffer (FUJIFILM Wako Pure Chemical Corporation) using Screen Fect siRNA (FUJIFILM Wako Pure Chemical Corporation), according to the manufacturer’s protocol. SiRNA sequences were as follows: RPL11 siRNA#1, 5′-GGUGCGGGAGUAUGAGUUA-3; RPL11 siRNA#2, 5′-CAAAUAAAUUCCCGUUUCUAUCC-3; scramble siRNA, 5′-UUCUCCGAACGUGUCACGU-3′.
+ Open protocol
+ Expand
4

Protein Stability Assay in HEK293 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293 cells with stable expressions of RNF183, RNF152, or HRD1 were transfected with short interfering RNA (siRNA) against Sec16A (CCAGGUGUUUAAGUUCAUCUA) using ScreenFect siRNA (Wako Pure Chemical Industries). At 44 h post-transfection, cells were incubated with 30 μg/ml cycloheximide (Wako Pure Chemical Industries) and 10 μM MG-132 (Wako Pure Chemical Industries) for 0, 1, 2, or 4 h and were subsequently harvested. Proteins were extracted using lysis buffer [20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 10% glycerol, 1% Triton X-100, 100 μM MG-132, Protease inhibitor cocktail Set V (Wako Pure Chemical Industries)]. The lysates were boiled with Laemmli SDS-PAGE sample buffer and subjected to Western blotting using a WSE-6100 LuminoGraph (ATTO Corporation, Tokyo, Japan).
+ Open protocol
+ Expand
5

Crb3 Gene Silencing in OSCC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Crb3 gene silencing in OSCC cells was performed using Silencer Select pre-designed siRNAs (Thermo Fisher Scientific). The product number and target sequence of siRNAs used to knock-down Crb3 were as follows: siCrb3−1 (#s40936, CAGGGAAGAAGGUACUUCA), siCrb3−2 (#s195567, AGUGCUUAAUAGCAGGGAA). Silencer select Negative Control No. 1 siRNA (#4390843, Thermo Fisher Scientific) was used as a control. siRNAs (10 nM final concentration) were transfected using ScreenFect™ siRNA (#299-75001, FUJIFILM Wako Chemicals) and a forward transfection protocol.
+ Open protocol
+ Expand
6

PCP4/PEP19 Knockdown and Overexpression in Neural Differentiation

Check if the same lab product or an alternative is used in the 5 most similar protocols
M17 cells were subcultured in appropriate plates or dishes for experiments, and transfected the next day with predesigned siRNA (ID: HSS143251) for knockdown of PCP4/PEP19 or Stealth RNAi siRNA Negative Control (Thermo Fisher Scientific) using ScreenFect siRNA (FUJIFILM Wako Pure Chemical). For PCP4/PEP19 overexpression experiments in SH-SY5Y cells, a CMVdriven expression vector harboring PCP4/PEP19 cDNA (OriGene Technologies, Rockville, MD, USA) was transfected using Lipofectamine 3000 (Thermo Fisher Scientific). After 5 days of AtRA treatment, the cells were harvested and extracted mRNA was subjected to qRT-PCR for the detection of PCP4/PEP19, Ascl1 and NeuroD1 mRNA expression.
+ Open protocol
+ Expand
7

siRNA Knockdown of DT Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
For knockdown experiments, 2 × 105 DT cells were seeded onto six‐well plates and transfected with siRNA (20–40 nM) using ScreenFect siRNA (295‐75003, FUJIFILM Wako). Details of siRNA sequences are provided in Appendix S1.
+ Open protocol
+ Expand
8

Plasmid and siRNA Transfection Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cell transfection was performed as previously described [45 (link)]. Cultured cells were transfected with plasmid DNA and PEI MAX (Polysciences, Warrington, PA, USA) complexes (ratio of DNA to PEI MAX, 1:3, w/w) formed in Opti-MEM I by incubating for 15 min at 25°C. The DNA complexes were added to cell cultures together with Opti-MEM for 3 h, followed by cultivation with serum-containing DMEM. For transfection of siRNAs, we used ScreenFect siRNA (FUJIFILM-Wako, Osaka, Japan) according to the manufacturer’s protocol, and pCAG-EGFP plasmid was co-transfected to identify cells that underwent successful knockdown. PCNs were electroporated with plasmid DNA using a NEPA21 Electroporator (Nepagene, Chiba, Japan) according to the manufacturer’s protocols (two pulses of 275 V for 0.5 ms with an interval of 50 ms).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!