Fibroblast cell lines include: BJ-5ta (ATCC, CRL-4001), BJ1-hTERT (kind gift from Vilhelm A. Bohr, Laboratory of Molecular Genetics, Gerontology Research Center, National Institute on Aging, National Institutes of Health, Baltimore, MD), MRC-5 (kind gift from Tim Sparer, University of Tennessee, Knoxville, Knoxville, TN), AG04405 (ATM-hTERT) (kind gift from Peter Lansdorp, University of British Columbia, Vancouver, Canada), and GM02052 (Coriell). The lymphoblastoid cell line GM12878 (Coriell) was also used. Information about cell lines and media formulations is summarized in Supplementary Table 2 . All growth media and fetal bovine serum was purchased from Corning, except for GM12878 growth media from Gibco. All fibroblast lines were passaged at a density of 80%. For irradiation experiments, fibroblast lines were grown to confluency prior to X-ray exposure. For the GM12878 suspension cell line, cells were passaged at a density around 500,000 cells per 1 mL of medium. For irradiation experiments, GM12878 cells were grown to a density of 1 million cells per 1 mL of medium prior to X-ray exposure.
Gm12878
Manufactured by Thermo Fisher Scientific
Sourced in United States
GM12878 is a human B-lymphocyte cell line derived from a Caucasian female. It is a widely used reference cell line for various research applications.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (7 mentions)
Glutamax, by Thermo Fisher Scientific (6 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (5 mentions)
Gm12878, by Coriell Institute for Medical Research (4 mentions)
L glutamine, by Thermo Fisher Scientific (3 mentions)
Iscove modified dulbecco media (imdm), by Thermo Fisher Scientific (2 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (2 mentions)
Gentamicin, by Thermo Fisher Scientific (2 mentions)
Hek293, by American Type Culture Collection (2 mentions)
Gm05756, by Coriell Institute for Medical Research (2 mentions)
Nih3t3, by American Type Culture Collection (2 mentions)
Hek293, by Thermo Fisher Scientific (2 mentions)
Roswell park memorial institute (rpmi), by Thermo Fisher Scientific (2 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (2 mentions)
Oci ly7, by Thermo Fisher Scientific (2 mentions)
Bj 5ta, by American Type Culture Collection (1 mentions)
Mrc 5, by Coriell Institute for Medical Research (1 mentions)
Gm02052, by Coriell Institute for Medical Research (1 mentions)
Fetal bovine serum (fbs), by Corning (1 mentions)
Hepg2, by Thermo Fisher Scientific (1 mentions)
9 protocols using gm12878
1
Fibroblast and Lymphoblastoid Cell Lines for Radiation Studies
2
Cell Culture Conditions for Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HeLa, HepG2 and 293T cells were purchased from the China Center for Type Culture Collection (Shanghai, China). GM12878 cell were purchased from the GuangZhou Jennio Biotech Co.,Ltd. (GuangZhou, China). HeLa, HepG2 and 293T cells were grown in Dulbecco’s Modified Eagle’s Medium (DMEM, GIBCO), GM12878 cells were cultured in RPMI 1640, which were all supplemented with 10% fetal bovine serum (FBS, GIBCO) with 100 μg/mL streptomycin and 100 units/mL penicillin at 37 °C in 5% CO2.
3
Cell Culture Protocols for DLBCL Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human B lymphocyte (GM12878) and DLBC cell lines (SUDHL4, OCI-Ly8, and OCI-Ly7) were brought from Cobioer (Nanjing, China). HBL1 DLBC cell line was provided by Shanghai Yaji Biotechnology Co., Ltd (China). GM12878 was cultured in Iscove’s modified Dulbecco’s medium (IMDM) (Gibco), and SUDHL4 was cultured in RPMI 1640 medium (Gibco). Each medium contained 10% of FBS and 1% of P/S. OCI-Ly8 and OCI-Ly7 were cultured in IMDM (Gibco) (20% FBS and 1% P/S). All cells were incubated with 5% CO2 at 37°C.
4
Transcriptomic Analysis of Diverse Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissues of brain, eye, heart, intestine, liver, skeletal muscle, and pooled oocytes of an adult female, and the testis of an adult male Arctic lamprey, L. camtschaticum, from the Shiribetsu river, Hokkaido, Japan, were dissected, snap frozen in liquid nitrogen, and kept at −80 °C until use. L. camtschaticum embryos obtained by artificial fertilization were sampled as pools at stages 25 and 27, according to the embryonic staging of L. reissneri33 and stored as above. Fertilized chicken eggs were obtained from a local farm. Chicken embryos used were at stage 25 according to the embryonic staging by Hamburger and Hamilton34 , snap frozen, and kept at −80 °C until use. Human lymphoblastoid cell line GM12878, was purchased from the Coriell Cell Repositories and cultured in RPMI-1640 media (Gibco) supplemented with 15% FBS, 2 mM L-glutamine, and 1x antibiotic-antimycotic solution (Gibco), at 37 °C, 5% CO2. Animal care and experimental procedures were conducted in accordance with guidelines approved by the Institutional Animal Care and Use Committee (IACUC), RIKEN Kobe Branch.
5
Cell Culture Protocols for Various Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissue culture cell lines (GM12878, Coriell; NIH/3T3, ATCC CRL-1658; HEK293, ATCC CRL-1554; Primary Fibro., inguinal fibroblast, GM05756, Coriell, passage 7) were cultured in 5% CO2 at 37°C. GM12878 cells were grown in Roswell Park Memorial Institute media (RPMI, Gibco, Cat. 11875093) supplemented with 15% (v/v) fetal bovine serum (FBS, Gibco, Cat. 10082147), 1X L-glutamine (Gibco, Cat. 25030081), 1X Penicillin-Streptomycin (Gibco, Cat. 15140122), and gentamicin (Gibco, Cat. 15750060). HEK293 cells were grown in Dulbecco’s Modified Eagle’s media (DMEM, Gibco, Cat. 11995065), supplemented with 10% FBS (v/v), and 1X L-glutamine. NIH/3T3 cells were grown in the same preparation of DMEM as HEK293 cells. Primary Fibroblasts were cultured in a growth medium comprised of DMEM/F12 (with GlutaMax; Thermo Fisher), 10% fetal bovine serum (FBS; Thermo Fisher, v/v), 1% MEM Non-Essential Amino Acids (Thermo Fisher, v/v), and 1X Penicillin-Streptomycin (Gibco). Adherent cell lines were grown to ~90% confluency at the time of harvest.
6
Culturing Human B-cell Lymphoma Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human B lymphocytes (GM12878) and DLBC cell lines (SU-DHL-8, OCI-Ly8 and OCI-Ly7) were purchased from BeNa Culture Collection; Beijing Beina Chunglian Institute of Biotechnology. GM12878 cells were cultured in Iscove's modified Dulbecco's medium (IMDM; Gibco; Thermo Fisher Scientific, Inc.) containing 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin (P/S). SU-DHL-8 cells were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) containing 10% FBS and 1% P/S. OCI-Ly8 and OCI-Ly7 cells were cultured in IMDM containing 20% FBS and 1% P/S. All cells were cultured in a humidified atmosphere of 5% CO2 at 37°C.
7
Cell Culture Protocols for Various Cell Lines
8
Cell Lines for Leukemia Research
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MHH-CALL2, SEM, REH B-ALL and HeLa cell lines were obtained from the DMSZ (Braunschweig, Germany), GM12878 and GM11832 lymphoblastoid cell lines (LCL) were obtained through the Coriell Institute (Camden NJ, US). Cell lines were maintained at 37 °C, with 5% CO2 in either RPMI with 10% FBS (REH, GM12878 and GM11832), 20% FBS RMPI (MHH-CALL2) or 10% DMEM (HeLa) supplemented with GlutaMAX (ThermoFisher Scientific, Waltham, MA, USA). REH BCP-ALL cell line used as a model of ETV6:RUNX1 translocation positive ALL. Cell line identity confirmed by translocation specific PCR primers available on request. HeLa cell line used as a non B-cell control. Cell lines were tested for mycoplasma (PCR Mycoplasma Test Kit I/C, PromoCell, Heidelberg, Germany), no positive results were obtained.
9
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA from GM12878, THP-1 and U937 cell lines (Thermo Fisher, USA) was extracted using TRIzol reagent. cDNA was created from 500 ng of RNA using the HiScript II SuperMix (Vazyme, China). By applying the SYBR Green Master Mix, RT-qPCR was carried out in ABI 7500 System (Thermo Fisher, USA). 45 cycles of 94 °C for 10 min, 94 °C for 10 s, and 60 °C for 45 s each comprised the PCR amplification conditions. Table 1 displayed the list of the sequences of primer pairs for targeted genes.
The primers of genes
| Genes | Forward primer sequence (5’-3’) | Reverse primer sequence (5’-3’) |
|---|---|---|
| CD83 | AAGGGGCAAAATGGTTCTTTCG | GCACCTGTATGTCCCCGAG |
| NRIP1 | GGATCAGGTACTGCCGTTGAC | CTGGACCATTACTTTGACAGGTG |
| ACSL1 | CCATGAGCTGTTCCGGTATTT | CCGAAGCCCATAAGCGTGTT |
| METTL7B | GCAACCGCAAGATGGAGAG | GATTTGGGTCTAGGCAGGTGA |
| OGT | TCCTGATTTGTACTGTGTTCGC | AAGCTACTGCAAAGTTCGGTT |
| C4orf48 | CGTCCGAATGGGCGTTTTC | TGCATGAACTCGAAGGCGT |
| GAPDH | AATGGGCAGCCGTTAGGAAA | GCCCAATACGACCAAATCAGAG |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!